Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21613
Trapped Gene
Larp5 (ENSMUSG00000033499)
Vector Insertion
Chr 13: 9157476 - 9157796
Public Clones not available
Private Clones OST323924 (lexicon)
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000252125 (Chr13:9157369..9157475 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCTTCAAACCTGCAACGTC Chr13:9157417..9157436 60.16 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000252125 (Chr13:9157369..9157475 +)
Downstram Exon
ENSMUSE00000252119 (Chr13:9157797..9158048 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCTTCAAACCTGCAACGTC Chr13:9157417..9157436 60.16 50 CATGGCGCAGATGAGACTTA Chr13:9157828..9157847 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684821 Chr13:9093151..9093426 CTCGAGGTTGAGACATTTTCG Chr13:9093202..9093222 59.86 47.62
upstream ENSMUSE00000572077 Chr13:9121354..9121472 TGGAGCCCATGACTTCTGAT Chr13:9121384..9121403 60.62 50
upstream ENSMUSE00000643976 Chr13:9123149..9123208 TGGTCCTATATCGCAAACCA Chr13:9123154..9123173 58.99 45
upstream ENSMUSE00000643972 Chr13:9136025..9136172 AGCTGTTGGTGTGAATGCTG Chr13:9136108..9136127 59.9 50
upstream ENSMUSE00000643968 Chr13:9136401..9136547 ATGGTGATGGCGACAAAAGT Chr13:9136419..9136438 60.38 45
upstream ENSMUSE00000643964 Chr13:9143000..9143078 AGGAAGACCCTCGGGAAGTA Chr13:9143027..9143046 60.07 55
upstream ENSMUSE00000643960 Chr13:9144628..9144764 GTGCCAATTACAACGGTAGC Chr13:9144683..9144702 58.17 50
upstream ENSMUSE00000643959 Chr13:9146647..9146750 CAAATCAGAACCGGTGCATAG Chr13:9146692..9146712 60.51 47.62
upstream ENSMUSE00000252145 Chr13:9149072..9149182 No primer for this exon
upstream ENSMUSE00000252139 Chr13:9150111..9150164 TTTCCAAGGAAAGCCAATTAAG Chr13:9150143..9150164 59.62 36.36
upstream ENSMUSE00000252132 Chr13:9150261..9150470 CCAGACGTGGTCAACAACAC Chr13:9150428..9150447 60.05 55
upstream ENSMUSE00000252125 Chr13:9157369..9157475 ACCTTCAAACCTGCAACGTC Chr13:9157417..9157436 60.16 50

*** Putative Vector Insertion (Chr 13: 9157476 - 9157796) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000252119 Chr13:9157797..9158048 CATGGCGCAGATGAGACTTA Chr13:9157828..9157847 59.97 50
downstream ENSMUSE00000252111 Chr13:9163921..9163966 TTTCTTCCGATAGCCAAAGG Chr13:9163951..9163970 59.29 45
downstream ENSMUSE00000252103 Chr13:9165563..9165727 AGTTGGACAGTCCCAGTTCG Chr13:9165635..9165654 60.15 55
downstream ENSMUSE00000252095 Chr13:9167924..9168048 CTCTGGGTCCCACTACAGGA Chr13:9167978..9167997 60.1 60
downstream ENSMUSE00000252088 Chr13:9168144..9168252 TTCACCTGCACGGATTTACA Chr13:9168242..9168261 60.11 45
downstream ENSMUSE00000410939 Chr13:9169898..9172332 CTGCTGGACACCCTACCAAT Chr13:9170619..9170638 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTTGCTTTCAGTGCTCAT Chr13:9157487..9157507 60.26 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTTGCTTTCAGTGCTCAT Chr13:9157487..9157507 60.26 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033499