Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21616
Trapped Gene
Tmem32 (ENSMUSG00000061273)
Vector Insertion
Chr X: 53842481 - 53844254
Public Clones not available
Private Clones OST323836 (lexicon)
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000412050 (ChrX:53844255..53844358 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCATATCGCAGGGGAGTTC ChrX:53844290..53844309 60.04 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000412050 (ChrX:53844255..53844358 -)
Downstram Exon
ENSMUSE00000366591 (ChrX:53838689..53842480 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCATATCGCAGGGGAGTTC ChrX:53844290..53844309 60.04 50 ATTGTGCATACTTGCCACCA ChrX:53838874..53838893 59.99 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000436074 ChrX:53850962..53851096 TTGTAGGTGTCGGGCTTTTT ChrX:53850996..53851015 59.61 45
upstream ENSMUSE00000364351 ChrX:53848567..53848619 TGCGACTAACAGAAAAGGAAGA ChrX:53848586..53848607 59.15 40.91
upstream ENSMUSE00000412050 ChrX:53844255..53844358 TTCATATCGCAGGGGAGTTC ChrX:53844290..53844309 60.04 50

*** Putative Vector Insertion (Chr X: 53842481 - 53844254) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000366591 ChrX:53838689..53842480 ATTGTGCATACTTGCCACCA ChrX:53838874..53838893 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGGGGAGTTCAAAGACAT ChrX:53844280..53844300 59.14 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGGGGAGTTCAAAGACAT ChrX:53844280..53844300 59.14 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061273