Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21617
Trapped Gene
Exosc5 (ENSMUSG00000061286)
Vector Insertion
Chr 7: 26451362 - 26452718
Public Clones not available
Private Clones OST323822 (lexicon) OST32602 (lexicon)
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000512779 (Chr7:26451272..26451361 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGGGGCTCTATTCTGACG Chr7:26451337..26451356 59.83 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000512779 (Chr7:26451272..26451361 +)
Downstram Exon
ENSMUSE00000598239 (Chr7:26452719..26453041 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGGGGCTCTATTCTGACG Chr7:26451337..26451356 59.83 55 ATTCCCGGTAGAATCGGAAG Chr7:26452785..26452804 60.28 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000506623 Chr7:26444221..26444402 CTCACTGACACCGGAACAGA Chr7:26444288..26444307 59.86 55
upstream ENSMUSE00000508430 Chr7:26448156..26448269 CCACCCTTGAAGTGATCCTG Chr7:26448228..26448247 60.5 55
upstream ENSMUSE00000511402 Chr7:26449346..26449467 GCTGGTCAGGAATACCTGTGA Chr7:26449371..26449391 60.13 52.38
upstream ENSMUSE00000513713 Chr7:26450440..26450580 CTGATGGAAATCTCGTGCTG Chr7:26450537..26450556 59.39 50
upstream ENSMUSE00000512779 Chr7:26451272..26451361 CAAGGGGCTCTATTCTGACG Chr7:26451337..26451356 59.83 55

*** Putative Vector Insertion (Chr 7: 26451362 - 26452718) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000598239 Chr7:26452719..26453041 ATTCCCGGTAGAATCGGAAG Chr7:26452785..26452804 60.28 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGAAGCTGCTCATGTCCAC Chr7:26451315..26451335 59.58 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGAAGCTGCTCATGTCCAC Chr7:26451315..26451335 59.58 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061286