Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21628
Trapped Gene
Centa2 (ENSMUSG00000020709)
Vector Insertion
Chr 11: 79975763 - 79979174
Public Clones (ggtc) (ggtc) IST11217H6BBF1 (tigm) IST14955H8 (tigm)
Private Clones OST323510 (lexicon) OST271949 (lexicon)
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000108363 (Chr11:79975650..79975762 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000108363 (Chr11:79975650..79975762 +)
Downstram Exon
ENSMUSE00000108358 (Chr11:79979175..79979321 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349664 Chr11:79967613..79967811 No primer for this exon
upstream ENSMUSE00000283569 Chr11:79968492..79968622 No primer for this exon
upstream ENSMUSE00000108355 Chr11:79970447..79970538 No primer for this exon
upstream ENSMUSE00000108361 Chr11:79973665..79973744 No primer for this exon
upstream ENSMUSE00000108363 Chr11:79975650..79975762 No primer for this exon

*** Putative Vector Insertion (Chr 11: 79975763 - 79979174) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000108358 Chr11:79979175..79979321 No primer for this exon
downstream ENSMUSE00000108360 Chr11:79984180..79984263 No primer for this exon
downstream ENSMUSE00000108356 Chr11:79987590..79987652 No primer for this exon
downstream ENSMUSE00000108353 Chr11:79989558..79989635 No primer for this exon
downstream ENSMUSE00000373060 Chr11:79990548..79990776 No primer for this exon
downstream ENSMUSE00000332693 Chr11:79991898..79992417 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCCTGGCAAGGATGTAAT Chr11:79975798..79975818 60.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGGAAGGCCTCCTGAAGTA Chr11:79978728..79978748 60.2 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020709