Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21629
Trapped Gene
Tbca (ENSMUSG00000042043)
Vector Insertion
Chr 13: 95602421 - 95607062
Public Clones not available
Private Clones OST323500 (lexicon) OST230497 (lexicon) OST215973 (lexicon) OST193244 (lexicon)
OST61374 (lexicon)
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000301695 (Chr13:95602315..95602420 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAAGGCTGAAGATGGAGAGA Chr13:95602380..95602400 60.08 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000301695 (Chr13:95602315..95602420 +)
Downstram Exon
ENSMUSE00000301686 (Chr13:95607063..95607149 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAAGGCTGAAGATGGAGAGA Chr13:95602380..95602400 60.08 47.62 ATCATCATCCGGGACTCTTG Chr13:95607097..95607116 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000301703 Chr13:95558898..95558957 No primer for this exon
upstream ENSMUSE00000301695 Chr13:95602315..95602420 TGAAGGCTGAAGATGGAGAGA Chr13:95602380..95602400 60.08 47.62

*** Putative Vector Insertion (Chr 13: 95602421 - 95607062) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000301686 Chr13:95607063..95607149 ATCATCATCCGGGACTCTTG Chr13:95607097..95607116 59.89 50
downstream ENSMUSE00000452365 Chr13:95612605..95612852 GACCCCAGGATTTAATGCAA Chr13:95612732..95612751 59.76 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATGCTCAGTGCAGCCTTA Chr13:95605454..95605474 58.78 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCCTCGTGACTGGGAAAA Chr13:95605466..95605486 63.61 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042043