Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21633
Trapped Gene
Tdrd3 (ENSMUSG00000022019)
Vector Insertion
Chr 14: 87911578 - 87939203
Public Clones not available
Private Clones OST323440 (lexicon)
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000284824 (Chr14:87911452..87911577 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCATTCTTCGGGTATGACA Chr14:87911477..87911496 60.07 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000284824 (Chr14:87911452..87911577 +)
Downstram Exon
ENSMUSE00000388834 (Chr14:87939204..87939328 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCATTCTTCGGGTATGACA Chr14:87911477..87911496 60.07 45 TTGGTAAAACTGCTGCGTTG Chr14:87939302..87939321 59.91 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000612790 Chr14:87816489..87816655 CGAGCCTGAACAGCTAACCA Chr14:87816596..87816615 61.5 55
upstream ENSMUSE00000612789 Chr14:87856841..87856925 TTTCAGATGAAGGCGTTGAA Chr14:87856846..87856865 59.4 40
upstream ENSMUSE00000612788 Chr14:87858564..87858629 GACATCAACGGTGGAAAGGT Chr14:87858603..87858622 59.83 50
upstream ENSMUSE00000488064 Chr14:87871883..87872043 AATTCAGAAGGTCCGCAATG Chr14:87871906..87871925 60.07 45
upstream ENSMUSE00000553911 Chr14:87874506..87874647 GGTGGTGAAGTGGAACACCT Chr14:87874603..87874622 59.86 55
upstream ENSMUSE00000122963 Chr14:87877197..87877268 GCCCACCTCCTTTTCTACCT Chr14:87877240..87877259 59.58 55
upstream ENSMUSE00000122960 Chr14:87880541..87880690 AGCAAAGAACTGCTGCCATT Chr14:87880647..87880666 60.02 45
upstream ENSMUSE00000122962 Chr14:87885366..87885506 GGTCACCGAAATAGGGAGGT Chr14:87885426..87885445 60.19 55
upstream ENSMUSE00000122955 Chr14:87885999..87886155 TGAGAAAGCCCTGAAACACA Chr14:87886004..87886023 59.42 45
upstream ENSMUSE00000122958 Chr14:87886969..87887094 GCACCAAGCACGTTATTTGA Chr14:87887037..87887056 59.74 45
upstream ENSMUSE00000284834 Chr14:87905566..87906413 GACGGCACTCAGTCAAGACA Chr14:87905640..87905659 60.03 55
upstream ENSMUSE00000284824 Chr14:87911452..87911577 TGCATTCTTCGGGTATGACA Chr14:87911477..87911496 60.07 45

*** Putative Vector Insertion (Chr 14: 87911578 - 87939203) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000388834 Chr14:87939204..87939328 TTGGTAAAACTGCTGCGTTG Chr14:87939302..87939321 59.91 45
downstream ENSMUSE00000612787 Chr14:87945064..87945307 CCCCATTGCCTTGTGTAAAT Chr14:87945228..87945247 59.69 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTTCAGACAGAGGCATGG Chr14:87926559..87926579 59.42 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTTCAGACAGAGGCATGG Chr14:87926559..87926579 59.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022019