Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21635
Trapped Gene
1700029F12Rik (ENSMUSG00000052075)
Vector Insertion
Chr 13: 97800378 - 97804136
Public Clones not available
Private Clones OST323406 (lexicon) OST214220 (lexicon)
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000569699 (Chr13:97804137..97804317 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCCATGACAAGGAAATGAG Chr13:97804216..97804235 60.46 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000569699 (Chr13:97804137..97804317 -)
Downstram Exon
ENSMUSE00000611559 (Chr13:97800156..97800377 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCCATGACAAGGAAATGAG Chr13:97804216..97804235 60.46 50 ACTGACAATCCACGTGGTGA Chr13:97800195..97800214 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000569699 Chr13:97804137..97804317 GGCCATGACAAGGAAATGAG Chr13:97804216..97804235 60.46 50

*** Putative Vector Insertion (Chr 13: 97800378 - 97804136) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000611559 Chr13:97800156..97800377 ACTGACAATCCACGTGGTGA Chr13:97800195..97800214 60.01 50
downstream ENSMUSE00000640463 Chr13:97791819..97792543 TGCTGACCCATTGTTGATGT Chr13:97791997..97792016 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr13:97804065..97804085 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000052075