Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21659
Trapped Gene
Sf3b2 (ENSMUSG00000024853)
Vector Insertion
Chr 19: 5294377 - 5295040
Public Clones CMHD-GT_499G12-3 (cmhd)
Private Clones OST322831 (lexicon) OST7395 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000145520 (Chr19:5295041..5295087 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000145520 (Chr19:5295041..5295087 -)
Downstram Exon
ENSMUSE00000145508 (Chr19:5294299..5294376 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCCCATCTTCTCCTCTCAAA Chr19:5294309..5294328 59.21 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000145518 Chr19:5295262..5295411 GCCAGATTGGCAGAGATAGG Chr19:5295276..5295295 59.8 55
upstream ENSMUSE00000145520 Chr19:5295041..5295087 No primer for this exon

*** Putative Vector Insertion (Chr 19: 5294377 - 5295040) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000145508 Chr19:5294299..5294376 CCCCATCTTCTCCTCTCAAA Chr19:5294309..5294328 59.21 50
downstream ENSMUSE00000390819 Chr19:5293080..5293319 CAGCTTCAGCCGTTCTTCTT Chr19:5293109..5293128 59.76 50
downstream ENSMUSE00000351909 Chr19:5291305..5291422 CCGTTCCTGCTCCATTAACA Chr19:5291374..5291393 61.02 50
downstream ENSMUSE00000256474 Chr19:5288304..5288413 No primer for this exon
downstream ENSMUSE00000145505 Chr19:5287910..5288006 No primer for this exon
downstream ENSMUSE00000145517 Chr19:5287535..5287626 ACACCGTGTCCTCCTCAGTC Chr19:5287530..5287549 60.16 60
downstream ENSMUSE00000360179 Chr19:5287069..5287284 CTCAATCTCCACGTCAGCAG Chr19:5287119..5287138 59.57 55
downstream ENSMUSE00000361123 Chr19:5286811..5286948 CCTTGTGCTCCTCCTCAAAG Chr19:5286821..5286840 59.98 55
downstream ENSMUSE00000405373 Chr19:5286577..5286657 TGCTTGAGTTCTGCCACAGT Chr19:5286556..5286575 59.62 50
downstream ENSMUSE00000392017 Chr19:5286189..5286416 GTCACGTCATGCATCTCCAC Chr19:5286354..5286373 60.13 55
downstream ENSMUSE00000145534 Chr19:5284575..5284724 CAATGTCGATCTTCCCCATC Chr19:5284633..5284652 60.28 50
downstream ENSMUSE00000145536 Chr19:5283858..5283947 TTCTTCTCCTTCAGCCGTGT Chr19:5283891..5283910 59.99 50
downstream ENSMUSE00000145544 Chr19:5283643..5283750 TCCAGGGATTTTCAGGTTTG Chr19:5283642..5283661 59.9 45
downstream ENSMUSE00000145540 Chr19:5279842..5279949 CCAAACACGTCCCCATAGAG Chr19:5279842..5279861 60.37 55
downstream ENSMUSE00000145529 Chr19:5279470..5279612 GGGTCCGGTCAATTTCTTCT Chr19:5279557..5279576 60.31 50
downstream ENSMUSE00000145542 Chr19:5279269..5279370 CATCGCCTCTTCGATCTTCT Chr19:5279252..5279271 59.53 50
downstream ENSMUSE00000145538 Chr19:5275064..5275163 CCCAACAGTGGCTGTTCTCT Chr19:5275084..5275103 60.3 55
downstream ENSMUSE00000145531 Chr19:5274792..5274977 CGAACGTGCTCCTCGTACTT Chr19:5274840..5274859 60.45 55
downstream ENSMUSE00000339566 Chr19:5273935..5274527 AGCTATGCGAGCAGGACCTA Chr19:5274417..5274436 60.14 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCCGTCAGGTGAGTGTTGT Chr19:5295028..5295048 60.48 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGGGAGTCGCGAGGAGTTA Chr19:5295069..5295089 59.97 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024853