Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21668
Trapped Gene
Ndufc1 (ENSMUSG00000037152)
Vector Insertion
Chr 3: 51209542 - 51211257
Public Clones not available
Private Clones OST321921 (lexicon) OST318639 (lexicon) OST316925 (lexicon) OST312128 (lexicon)
OST205510 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000376548 (Chr3:51211258..51211334 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCATCCAAACACACAATGAAGA Chr3:51211312..51211334 60.02 39.13 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000376548 (Chr3:51211258..51211334 -)
Downstram Exon
ENSMUSE00000512971 (Chr3:51209401..51209541 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCATCCAAACACACAATGAAGA Chr3:51211312..51211334 60.02 39.13 ATCCGTCACTGAGGGTGAAT Chr3:51209464..51209483 59.38 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000568267 Chr3:51212786..51212860 GTAGTGCTGCGCTCGTTTTC Chr3:51212821..51212840 61.11 55
upstream ENSMUSE00000265671 Chr3:51212067..51212170 AACTGGTTGGCAGTTGGACT Chr3:51212101..51212120 59.62 50
upstream ENSMUSE00000376548 Chr3:51211258..51211334 CTCATCCAAACACACAATGAAGA Chr3:51211312..51211334 60.02 39.13

*** Putative Vector Insertion (Chr 3: 51209542 - 51211257) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000512971 Chr3:51209401..51209541 ATCCGTCACTGAGGGTGAAT Chr3:51209464..51209483 59.38 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr3:51211187..51211207 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGTTTCGTGACTGGGAAA Chr3:51211193..51211213 60.13 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037152