Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21674
Trapped Gene
Ddx39 (ENSMUSG00000005481)
Vector Insertion
Chr 8: 86243285 - 86243498
Public Clones not available
Private Clones OST321491 (lexicon) OST318895 (lexicon) OST301720 (lexicon) OST277886 (lexicon)
OST220369 (lexicon) OST213087 (lexicon) OST203460 (lexicon) OST189738 (lexicon)
OST177198 (lexicon) OST92804 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000708889 (Chr8:86243286..86243497 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000708889 (Chr8:86243286..86243497 +)
Downstram Exon
ENSMUSE00000708243 (Chr8:86243286..86243497 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000606769 Chr8:86239167..86239236 No primer for this exon
upstream ENSMUSE00000681691 Chr8:86239447..86239745 No primer for this exon

*** Putative Vector Insertion (Chr 8: 86243285 - 86243498) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000708243 Chr8:86243286..86243497 No primer for this exon
downstream ENSMUSE00000708889 Chr8:86243286..86243497 No primer for this exon
downstream ENSMUSE00000718405 Chr8:86243286..86243497 No primer for this exon
downstream ENSMUSE00000581499 Chr8:86243711..86243838 No primer for this exon
downstream ENSMUSE00000706428 Chr8:86243711..86243838 No primer for this exon
downstream ENSMUSE00000581498 Chr8:86244448..86244540 No primer for this exon
downstream ENSMUSE00000706427 Chr8:86244448..86244540 No primer for this exon
downstream ENSMUSE00000581497 Chr8:86244856..86245039 No primer for this exon
downstream ENSMUSE00000706426 Chr8:86244856..86245039 No primer for this exon
downstream ENSMUSE00000706425 Chr8:86245365..86245423 No primer for this exon
downstream ENSMUSE00000434950 Chr8:86245633..86245751 No primer for this exon
downstream ENSMUSE00000706424 Chr8:86245633..86245751 No primer for this exon
downstream ENSMUSE00000581496 Chr8:86246129..86246260 No primer for this exon
downstream ENSMUSE00000706423 Chr8:86246129..86246260 No primer for this exon
downstream ENSMUSE00000581495 Chr8:86246348..86246457 No primer for this exon
downstream ENSMUSE00000434942 Chr8:86246548..86246692 No primer for this exon
downstream ENSMUSE00000434938 Chr8:86246786..86246933 No primer for this exon
downstream ENSMUSE00000606768 Chr8:86247024..86247247 No primer for this exon
downstream ENSMUSE00000706430 Chr8:86247024..86247174 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGCAGAACAGGATGTGGA Chr8:86243291..86243311 61.5 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000005481