Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21675
Trapped Gene
Sdsl (ENSMUSG00000029596)
Vector Insertion
Chr 5: 120908210 - 120908561
Public Clones not available
Private Clones OST321458 (lexicon) OST312798 (lexicon) OST21423 (lexicon) OST18571 (lexicon)
OST13455 (lexicon)
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000413622 (Chr5:120908212..120908560 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTACTCGGGCATCCTGTG Chr5:120908491..120908510 60.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000413622 (Chr5:120908212..120908560 -)
Downstram Exon
ENSMUSE00000538844 (Chr5:120908211..120908560 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTACTCGGGCATCCTGTG Chr5:120908491..120908510 60.1 55 CACAGGATGCCCGAGTAGAT Chr5:120908469..120908488 60.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000288583 Chr5:120922735..120922819 GTCTCACGTGGCTTCGTTCT Chr5:120922738..120922757 60.45 55
upstream ENSMUSE00000343830 Chr5:120922730..120922772 GTCTCACGTGGCTTCGTTCT Chr5:120922738..120922757 60.45 55
upstream ENSMUSE00000288577 Chr5:120917283..120917507 TGAGCTGCGTAAGGAAGACA Chr5:120917463..120917482 59.74 50
upstream ENSMUSE00000288568 Chr5:120913041..120913234 CCTTTAAGATTCGGGGCATC Chr5:120913059..120913078 60.76 50
upstream ENSMUSE00000708223 Chr5:120913041..120913234 CCTTTAAGATTCGGGGCATC Chr5:120913059..120913078 60.76 50
upstream ENSMUSE00000190550 Chr5:120912855..120912894 GACATCTGGTGTGCTCCTCA Chr5:120912856..120912875 59.83 55
upstream ENSMUSE00000288552 Chr5:120911986..120912125 No primer for this exon
upstream ENSMUSE00000288542 Chr5:120910616..120910704 CCGTTTGACCATCCCCTTAT Chr5:120910619..120910638 60.93 50
upstream ENSMUSE00000190544 Chr5:120909765..120909992 ACAGTTTCAATTCGGCCTTG Chr5:120909803..120909822 60.11 45
upstream ENSMUSE00000190538 Chr5:120909454..120909578 GTAGAAGACCGGGAGGCTGT Chr5:120909477..120909496 60.65 60
upstream ENSMUSE00000413622 Chr5:120908212..120908560 ATCTACTCGGGCATCCTGTG Chr5:120908491..120908510 60.1 55
upstream ENSMUSE00000538844 Chr5:120908211..120908560 ATCTACTCGGGCATCCTGTG Chr5:120908491..120908510 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTCCTCCCCACAGACGAT Chr5:120908554..120908574 62.48 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTCCTCCCCACAGACGAT Chr5:120908554..120908574 62.48 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029596