Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21678
Trapped Gene
Pdcd10 (ENSMUSG00000027835)
Vector Insertion
Chr 3: 75345301 - 75360643
Public Clones IST14672C10 (tigm)
Private Clones OST321445 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000361341 (Chr3:75360644..75360707 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAATTGATCCGGGAGTTGAA Chr3:75360688..75360707 59.87 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000361341 (Chr3:75360644..75360707 -)
Downstram Exon
ENSMUSE00000389259 (Chr3:75345082..75345300 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAATTGATCCGGGAGTTGAA Chr3:75360688..75360707 59.87 45 TTCACTGCCGAATTTCTTCC Chr3:75345209..75345228 60.19 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000361341 Chr3:75360644..75360707 GAATTGATCCGGGAGTTGAA Chr3:75360688..75360707 59.87 45

*** Putative Vector Insertion (Chr 3: 75345301 - 75360643) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000389259 Chr3:75345082..75345300 TTCACTGCCGAATTTCTTCC Chr3:75345209..75345228 60.19 45
downstream ENSMUSE00000173435 Chr3:75337463..75337516 GAGCTGCAGACAAATTTACTCG Chr3:75337467..75337488 59.18 45.46
downstream ENSMUSE00000173437 Chr3:75332732..75332849 AGGAGGGACTCGGTGAAGTT Chr3:75332736..75332755 60.11 55
downstream ENSMUSE00000173433 Chr3:75331510..75331636 CCGTGCCTTTTCATTTAGGT Chr3:75331559..75331578 59.09 45
downstream ENSMUSE00000173436 Chr3:75324953..75325031 CCTGCGGTTCTGGTACTGAT Chr3:75324931..75324950 60.13 55
downstream ENSMUSE00000173434 Chr3:75324624..75324706 No primer for this exon
downstream ENSMUSE00000225572 Chr3:75321028..75321523 AATTAGCCGGTTGGCACTTA Chr3:75321465..75321484 59.61 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTGAAGTCCGTGCCTCAG Chr3:75345648..75345668 60.44 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGTGAAGTCCGTGCCTCAG Chr3:75345648..75345668 60.44 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCCCAGTGCTTTGGAAGTAG Chr3:75348693..75348713 59.73 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTGAATTGATCCGGGAGTTG Chr3:75345688..75345708 60.32 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027835