Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21683
Trapped Gene
Agrp (ENSMUSG00000005705)
Vector Insertion
Chr 8: 108091393 - 108091505
Public Clones (sanger)
Private Clones OST321281 (lexicon) OST310382 (lexicon) OST280855 (lexicon) OST85835 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000580399 (Chr8:108091506..108091626 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000580399 (Chr8:108091506..108091626 -)
Downstram Exon
ENSMUSE00000341888 (Chr8:108091260..108091392 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000580400 Chr8:108092116..108092198 No primer for this exon
upstream ENSMUSE00000580399 Chr8:108091506..108091626 No primer for this exon

*** Putative Vector Insertion (Chr 8: 108091393 - 108091505) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000341888 Chr8:108091260..108091392 No primer for this exon
downstream ENSMUSE00000214388 Chr8:108091020..108091102 No primer for this exon
downstream ENSMUSE00000214390 Chr8:108090600..108090838 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGACATCCCTAGGCAAAG Chr8:108091518..108091538 59.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGAGCATCTCTCTCGTGAC Chr8:108091448..108091468 59.95 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCTGGCTACAGGAAGCAGTC Chr8:108091590..108091610 60.01 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCTGGCTACAGGAAGCAGTC Chr8:108091590..108091610 60.01 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005705