Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21686
Trapped Gene
AC175246.2 (ENSMUSG00000026361)
Vector Insertion
Chr 1: 145546453 - 145549623
Public Clones not available
Private Clones OST321094 (lexicon) OST255982 (lexicon) OST168222 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000335477 (Chr1:145549624..145549814 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAAGTGATCTTCGGGGAGT Chr1:145549667..145549686 59.65 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000335477 (Chr1:145549624..145549814 -)
Downstram Exon
ENSMUSE00000158420 (Chr1:145546347..145546452 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAAGTGATCTTCGGGGAGT Chr1:145549667..145549686 59.65 50 GGACATAAACAGGATGCGAAA Chr1:145546336..145546356 59.95 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000335477 Chr1:145549624..145549814 TGAAGTGATCTTCGGGGAGT Chr1:145549667..145549686 59.65 50

*** Putative Vector Insertion (Chr 1: 145546453 - 145549623) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158420 Chr1:145546347..145546452 GGACATAAACAGGATGCGAAA Chr1:145546336..145546356 59.95 42.86
downstream ENSMUSE00000158422 Chr1:145542523..145542592 AGATCTTTTCGGTCGGGTCT Chr1:145542527..145542546 60.07 50
downstream ENSMUSE00000158427 Chr1:145538544..145538606 CCGCTGAAGACCTATTTCCA Chr1:145538532..145538551 60.21 50
downstream ENSMUSE00000279140 Chr1:145538405..145538457 CAATCCGTGGTTTCTTTGCT Chr1:145538385..145538404 60.11 45
downstream ENSMUSE00000279133 Chr1:145533053..145533141 CTTTATGGCCTTCCAAACGA Chr1:145533059..145533078 60.07 45
downstream ENSMUSE00000158425 Chr1:145524769..145524985 CCACTGACATGGCTTCAGAC Chr1:145524938..145524957 59.26 55
downstream ENSMUSE00000158419 Chr1:145518460..145518558 ACGACCTTCTTCTCTGGCTTT Chr1:145518477..145518497 59.52 47.62
downstream ENSMUSE00000158416 Chr1:145517120..145517198 GCAGCTGGAATAGGCTGTTT Chr1:145517139..145517158 59.48 50
downstream ENSMUSE00000158418 Chr1:145514755..145514819 CCATGGTAGGTGCCCATAGT Chr1:145514755..145514774 59.69 55
downstream ENSMUSE00000279102 Chr1:145482162..145482219 GGCTGCAGGAGTTTGAGTCT Chr1:145482159..145482178 59.6 55
downstream ENSMUSE00000279097 Chr1:145474976..145475011 No primer for this exon
downstream ENSMUSE00000279089 Chr1:145474632..145474719 AATAATGGGTGTCCGTGACC Chr1:145474678..145474697 59.53 50
downstream ENSMUSE00000279080 Chr1:145464409..145464570 CCTGGTTGCATCTGGTCTTT Chr1:145464459..145464478 60.11 50
downstream ENSMUSE00000158413 Chr1:145462433..145462533 AAACAGCCACAACTCGATCC Chr1:145462492..145462511 60.12 50
downstream ENSMUSE00000158423 Chr1:145456500..145456641 CCCAGAAACGTAAGAAAACTGG Chr1:145456491..145456512 60.03 45.46
downstream ENSMUSE00000595574 Chr1:145454630..145455687 TCGGATACACACAGGCTGAC Chr1:145455110..145455129 59.71 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTAGTTTGGGGGTGAGTGC Chr1:145549614..145549634 60.95 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTAGTTTGGGGGTGAGTGC Chr1:145549614..145549634 60.95 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026361