Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21687
Trapped Gene
Zfp354c (ENSMUSG00000044807)
Vector Insertion
Chr 11: 50640013 - 50641080
Public Clones IST14504H11 (tigm)
Private Clones OST321056 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679130 (Chr11:50641081..50641225 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACATCCTCGAGACTGCTCGT Chr11:50641113..50641132 60.02 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679130 (Chr11:50641081..50641225 -)
Downstram Exon
ENSMUSE00000679129 (Chr11:50639928..50640012 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACATCCTCGAGACTGCTCGT Chr11:50641113..50641132 60.02 55 CGAGTGCTGACCAAATATGC Chr11:50639971..50639990 59.3 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679130 Chr11:50641081..50641225 ACATCCTCGAGACTGCTCGT Chr11:50641113..50641132 60.02 55

*** Putative Vector Insertion (Chr 11: 50640013 - 50641080) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000653822 Chr11:50639928..50639960 No primer for this exon
downstream ENSMUSE00000679129 Chr11:50639928..50640012 CGAGTGCTGACCAAATATGC Chr11:50639971..50639990 59.3 50
downstream ENSMUSE00000580006 Chr11:50631311..50631437 CACCTCTCGGTACAGGCTTC Chr11:50631323..50631342 59.87 60
downstream ENSMUSE00000103972 Chr11:50630621..50630713 TCTTTCCATGCAGGGATCTT Chr11:50630624..50630643 59.63 45
downstream ENSMUSE00000679128 Chr11:50627616..50629495 GGATCCTCTGATGCCGATAA Chr11:50628337..50628356 60 50
downstream ENSMUSE00000591537 Chr11:50624610..50629495 GGATCCTCTGATGCCGATAA Chr11:50628337..50628356 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTGCTCGTGCTGAGAGTG Chr11:50641101..50641121 59.92 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACTGCTCGTGCTGAGAGTG Chr11:50641101..50641121 59.92 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGCATGCCGGGAGTAGTAGT Chr11:50641230..50641250 61.42 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTAGTTCTCTGGGGCTTCTCC Chr11:50641214..50641235 59.34 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044807