Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21691
Trapped Gene
Dleu7 (ENSMUSG00000048281)
Vector Insertion
Chr 14: 62895946 - 62911364
Public Clones not available
Private Clones OST320970 (lexicon) OST232687 (lexicon) OST190597 (lexicon) OST186669 (lexicon)
OST180013 (lexicon) OST176001 (lexicon) OST134075 (lexicon) OST111904 (lexicon)
OST66346 (lexicon)
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000339702 (Chr14:62911365..62911800 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTTAGTGGCTTCCATCAG Chr14:62911753..62911772 59.69 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000339702 (Chr14:62911365..62911800 -)
Downstram Exon
ENSMUSE00000375213 (Chr14:62895068..62895945 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTTAGTGGCTTCCATCAG Chr14:62911753..62911772 59.69 55 CCATCGCTGCTGACTGTTTA Chr14:62895638..62895657 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000339702 Chr14:62911365..62911800 CCCTTAGTGGCTTCCATCAG Chr14:62911753..62911772 59.69 55

*** Putative Vector Insertion (Chr 14: 62895946 - 62911364) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000375213 Chr14:62895068..62895945 CCATCGCTGCTGACTGTTTA Chr14:62895638..62895657 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGACTGGTAATCGCCTTG Chr14:62908302..62908322 59.96 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTAGTCGTGACTGGGAAAACC Chr14:62908297..62908319 59.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048281