Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21704
Trapped Gene
Tubb5 (ENSMUSG00000001525)
Vector Insertion
Chr 17: 35972985 - 35973107
Public Clones not available
Private Clones OST320535 (lexicon) OST243177 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000544285 (Chr17:35973108..35973218 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000544285 (Chr17:35973108..35973218 -)
Downstram Exon
ENSMUSE00000376744 (Chr17:35971753..35972984 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000142136 Chr17:35974942..35975177 No primer for this exon
upstream ENSMUSE00000544289 Chr17:35973573..35973681 No primer for this exon
upstream ENSMUSE00000544285 Chr17:35973108..35973218 No primer for this exon

*** Putative Vector Insertion (Chr 17: 35972985 - 35973107) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000376744 Chr17:35971753..35972984 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCCAGATCTTCAGACCAGA Chr17:35973120..35973140 60.35 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCCAGATCTTCAGACCAGA Chr17:35973120..35973140 60.35 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001525