Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21711
Trapped Gene
Hapln2 (ENSMUSG00000004894)
Vector Insertion
Chr 3: 87828394 - 87830806
Public Clones not available
Private Clones OST320429 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000294665 (Chr3:87830807..87830862 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000294665 (Chr3:87830807..87830862 -)
Downstram Exon
ENSMUSE00000521020 (Chr3:87828252..87828393 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000294674 Chr3:87831307..87831362 No primer for this exon
upstream ENSMUSE00000294665 Chr3:87830807..87830862 No primer for this exon

*** Putative Vector Insertion (Chr 3: 87828394 - 87830806) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000521020 Chr3:87828252..87828393 No primer for this exon
downstream ENSMUSE00000175753 Chr3:87827687..87828040 No primer for this exon
downstream ENSMUSE00000294637 Chr3:87827446..87827562 No primer for this exon
downstream ENSMUSE00000294631 Chr3:87827143..87827325 No primer for this exon
downstream ENSMUSE00000436198 Chr3:87825983..87826747 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTTGCAGGTAGGCAATGG Chr3:87830794..87830814 60.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCTTGCAGGTAGGCAATGG Chr3:87830794..87830814 60.1 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004894