Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21733
Trapped Gene
Blvrb (ENSMUSG00000040466)
Vector Insertion
Chr 7: 28244274 - 28244440
Public Clones not available
Private Clones OST319427 (lexicon) OST67164 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676418 (Chr7:28244275..28244439 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTATGAGGTGACGGTGCTG Chr7:28244275..28244294 59.17 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676418 (Chr7:28244275..28244439 +)
Downstram Exon
ENSMUSE00000306762 (Chr7:28244275..28244439 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTATGAGGTGACGGTGCTG Chr7:28244275..28244294 59.17 55 CAGCACCGTCACCTCATAAC Chr7:28244297..28244316 59.17 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000466644 Chr7:28233051..28233215 TCCTCGGAGTTCTCAGCTTT Chr7:28233096..28233115 59.16 50
upstream ENSMUSE00000676431 Chr7:28233077..28233215 TCCTCGGAGTTCTCAGCTTT Chr7:28233096..28233115 59.16 50
upstream ENSMUSE00000676420 Chr7:28237437..28237569 ATGAGAAGCGGCTGTCTAGC Chr7:28237486..28237505 59.75 55

*** Putative Vector Insertion (Chr 7: 28244274 - 28244440) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000306762 Chr7:28244275..28244439 CAGCACCGTCACCTCATAAC Chr7:28244297..28244316 59.17 55
downstream ENSMUSE00000676418 Chr7:28244275..28244439 CAGCACCGTCACCTCATAAC Chr7:28244297..28244316 59.17 55
downstream ENSMUSE00000676425 Chr7:28244275..28244652 TACTGAGGTCGTTGCCAGTG Chr7:28244445..28244464 59.9 55
downstream ENSMUSE00000306752 Chr7:28244582..28244671 TTCATGGCTGTCACGATGTT Chr7:28244636..28244655 60.12 45
downstream ENSMUSE00000676415 Chr7:28244582..28244671 TTCATGGCTGTCACGATGTT Chr7:28244636..28244655 60.12 45
downstream ENSMUSE00000306742 Chr7:28247586..28247714 TCACTGCCACGTATTTCAGC Chr7:28247702..28247721 59.87 50
downstream ENSMUSE00000363036 Chr7:28250739..28251004 TCCCCACCTAGGTCAGAGTG Chr7:28250919..28250938 60.1 60
downstream ENSMUSE00000676413 Chr7:28250739..28251003 TCCCCACCTAGGTCAGAGTG Chr7:28250919..28250938 60.1 60
downstream ENSMUSE00000676423 Chr7:28250739..28251017 TCCCCACCTAGGTCAGAGTG Chr7:28250919..28250938 60.1 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTATGAGGTGACGGTGCTG Chr7:28244276..28244296 59.17 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTATGAGGTGACGGTGCTG Chr7:28244276..28244296 59.17 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040466