Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21741
Trapped Gene
Hsf2bp (ENSMUSG00000002076)
Vector Insertion
Chr 17: 32170357 - 32171389
Public Clones not available
Private Clones OST319155 (lexicon) OST313963 (lexicon) OST304187 (lexicon) OST257874 (lexicon)
OST178080 (lexicon) OST131606 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000332606 (Chr17:32171390..32171437 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000332606 (Chr17:32171390..32171437 -)
Downstram Exon
ENSMUSE00000137499 (Chr17:32170206..32170356 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000332606 Chr17:32171390..32171437 No primer for this exon

*** Putative Vector Insertion (Chr 17: 32170357 - 32171389) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000137499 Chr17:32170206..32170356 No primer for this exon
downstream ENSMUSE00000313780 Chr17:32159711..32159814 No primer for this exon
downstream ENSMUSE00000313757 Chr17:32150263..32150412 No primer for this exon
downstream ENSMUSE00000444864 Chr17:32148121..32148253 No primer for this exon
downstream ENSMUSE00000137509 Chr17:32144621..32144738 No primer for this exon
downstream ENSMUSE00000137504 Chr17:32124293..32124396 No primer for this exon
downstream ENSMUSE00000313133 Chr17:32081714..32083756 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGCTGATTACTCCCCTCA Chr17:32171340..32171360 60.36 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGCTGATTACTCCCCTCA Chr17:32171340..32171360 60.36 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002076