Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21762
Trapped Gene
Rab2b (ENSMUSG00000022159)
Vector Insertion
Chr 14: 52885977 - 52888316
Public Clones not available
Private Clones OST318597 (lexicon)
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000124068 (Chr14:52888317..52888409 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGAAACCTTCAACCACCTGA Chr14:52888387..52888406 61.06 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000124068 (Chr14:52888317..52888409 -)
Downstram Exon
ENSMUSE00000124070 (Chr14:52885865..52885976 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGAAACCTTCAACCACCTGA Chr14:52888387..52888406 61.06 50 GGCTGTCTTGGCTGATGTTT Chr14:52885858..52885877 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000649025 Chr14:52898871..52899012 No primer for this exon
upstream ENSMUSE00000124067 Chr14:52898589..52898660 CGTGCACGACCTCACAATAG Chr14:52898589..52898608 60.32 55
upstream ENSMUSE00000124065 Chr14:52895118..52895185 TGGTCAACATCGATGGAAAA Chr14:52895145..52895164 59.9 40
upstream ENSMUSE00000124064 Chr14:52888593..52888675 TTCCGTTCTATCACCCGTTC Chr14:52888641..52888660 59.93 50
upstream ENSMUSE00000124068 Chr14:52888317..52888409 CGAAACCTTCAACCACCTGA Chr14:52888387..52888406 61.06 50

*** Putative Vector Insertion (Chr 14: 52885977 - 52888316) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000124070 Chr14:52885865..52885976 GGCTGTCTTGGCTGATGTTT Chr14:52885858..52885877 60.26 50
downstream ENSMUSE00000124066 Chr14:52884374..52884442 No primer for this exon
downstream ENSMUSE00000124069 Chr14:52881446..52883492 TCAGCCTAAGCAACGAGGAT Chr14:52883270..52883289 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGCGAACTTCCTTAATCG Chr14:52888259..52888279 59.98 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000022159