Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21768
Trapped Gene
Pttg1 (ENSMUSG00000020415)
Vector Insertion
Chr 11: 43236489 - 43238220
Public Clones not available
Private Clones OST318540 (lexicon)
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000104341 (Chr11:43238221..43238399 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000104341 (Chr11:43238221..43238399 -)
Downstram Exon
ENSMUSE00000104333 (Chr11:43236395..43236488 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000423675 Chr11:43239703..43239753 No primer for this exon
upstream ENSMUSE00000716720 Chr11:43239691..43239719 No primer for this exon
upstream ENSMUSE00000710174 Chr11:43239676..43239704 No primer for this exon
upstream ENSMUSE00000393782 Chr11:43239085..43239183 No primer for this exon
upstream ENSMUSE00000679744 Chr11:43239085..43239183 No primer for this exon
upstream ENSMUSE00000708756 Chr11:43239085..43239465 No primer for this exon
upstream ENSMUSE00000717320 Chr11:43239085..43239483 No primer for this exon
upstream ENSMUSE00000104341 Chr11:43238221..43238399 No primer for this exon

*** Putative Vector Insertion (Chr 11: 43236489 - 43238220) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000104333 Chr11:43236395..43236488 No primer for this exon
downstream ENSMUSE00000392671 Chr11:43234609..43234767 No primer for this exon
downstream ENSMUSE00000580198 Chr11:43234562..43234767 No primer for this exon
downstream ENSMUSE00000721468 Chr11:43233776..43233910 No primer for this exon
downstream ENSMUSE00000654251 Chr11:43233775..43233910 No primer for this exon
downstream ENSMUSE00000491764 Chr11:43233771..43233910 No primer for this exon
downstream ENSMUSE00000716263 Chr11:43233766..43234767 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGACCTTGACTGGGAAAAAG Chr11:43238219..43238239 59.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGACCTTGACTGGGAAAAAG Chr11:43238219..43238239 59.71 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020415