Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21777
Trapped Gene
Wdr41 (ENSMUSG00000042015)
Vector Insertion
Chr 13: 95746545 - 95748424
Public Clones not available
Private Clones OST318205 (lexicon) OST66641 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000569771 (Chr13:95746303..95746544 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCCAACGAGACTTCTGTTTT Chr13:95746382..95746402 60.51 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000569771 (Chr13:95746303..95746544 +)
Downstram Exon
ENSMUSE00000301527 (Chr13:95748425..95748540 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCCAACGAGACTTCTGTTTT Chr13:95746382..95746402 60.51 47.62 AAGTCATCGAGCCTCACCAG Chr13:95748540..95748559 60.41 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000569771 Chr13:95746303..95746544 CCCCAACGAGACTTCTGTTTT Chr13:95746382..95746402 60.51 47.62

*** Putative Vector Insertion (Chr 13: 95746545 - 95748424) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000301527 Chr13:95748425..95748540 AAGTCATCGAGCCTCACCAG Chr13:95748540..95748559 60.41 55
downstream ENSMUSE00000301520 Chr13:95765205..95765253 CTGGGCATTCCACACAACTA Chr13:95765256..95765275 59.57 50
downstream ENSMUSE00000680480 Chr13:95767011..95767143 CACGAGTCTAGGGGAGGAAA Chr13:95767093..95767112 59.28 55
downstream ENSMUSE00000680487 Chr13:95767011..95767142 CACGAGTCTAGGGGAGGAAA Chr13:95767093..95767112 59.28 55
downstream ENSMUSE00000680486 Chr13:95769821..95769883 TGGAAGCACGTGACTCTCTG Chr13:95769873..95769892 60.18 55
downstream ENSMUSE00000301504 Chr13:95769822..95769883 TGGAAGCACGTGACTCTCTG Chr13:95769873..95769892 60.18 55
downstream ENSMUSE00000301499 Chr13:95775686..95775797 ACACGCCTAGGTCACTACCG Chr13:95775749..95775768 60.19 60
downstream ENSMUSE00000301492 Chr13:95778763..95778825 AGTTCCCAGGGATTTCAACC Chr13:95778798..95778817 60.17 50
downstream ENSMUSE00000301486 Chr13:95780240..95780350 GGCAATTCTTCTGTGGGTGT Chr13:95780279..95780298 59.97 50
downstream ENSMUSE00000344656 Chr13:95782528..95782755 CACAGAGCCTATGGTCAGCA Chr13:95782592..95782611 60.01 55
downstream ENSMUSE00000346468 Chr13:95784986..95785170 GAGCCAGTGACGAAACCTGT Chr13:95785010..95785029 60.31 55
downstream ENSMUSE00000301477 Chr13:95787282..95787403 GTTTTCTGGCAGGCAATCAC Chr13:95787361..95787380 60.65 50
downstream ENSMUSE00000301468 Chr13:95788072..95788160 CCATCTTCCGAGCATGAGAT Chr13:95788101..95788120 60.18 50
downstream ENSMUSE00000301462 Chr13:95788787..95788920 AGATCTCCGATGAGCTCCAG Chr13:95788898..95788917 59.51 55
downstream ENSMUSE00000640631 Chr13:95791625..95793269 AAGAATTTCGCGTGTCCATC Chr13:95792694..95792713 60.08 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGGCCTAGCCGAGGTAAT Chr13:95746531..95746551 62.67 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGGCCTAGCCGAGGTAAT Chr13:95746531..95746551 62.67 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042015