Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21795
Trapped Gene
Abhd14b (ENSMUSG00000042073)
Vector Insertion
Chr 9: 106353966 - 106354314
Public Clones IST13399B8 (tigm) IST13668G11 (tigm)
Private Clones OST317797 (lexicon)
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000691830 (Chr9:106353785..106353965 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGACTACGCCAGTGTGAAG Chr9:106353946..106353965 59.9 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000691830 (Chr9:106353785..106353965 +)
Downstram Exon
ENSMUSE00000345857 (Chr9:106354315..106355246 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGACTACGCCAGTGTGAAG Chr9:106353946..106353965 59.9 55 AGCCCCTAAGGGAGATTTGA Chr9:106355124..106355143 60.03 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000583346 Chr9:106350992..106351040 AATAGCACACGCCATTCTCC Chr9:106350996..106351015 60.1 50
upstream ENSMUSE00000353718 Chr9:106352335..106352562 TGGCAGAACCTGGGTACTCT Chr9:106352493..106352512 59.72 55
upstream ENSMUSE00000691833 Chr9:106352753..106352790 CTTTGGGCTCACTTCCCTTC Chr9:106352757..106352776 61.12 55
upstream ENSMUSE00000691832 Chr9:106353628..106353634 No primer for this exon
upstream ENSMUSE00000261762 Chr9:106353724..106353965 TGGACTACGCCAGTGTGAAG Chr9:106353946..106353965 59.9 55
upstream ENSMUSE00000691831 Chr9:106353724..106353739 No primer for this exon
upstream ENSMUSE00000691830 Chr9:106353785..106353965 TGGACTACGCCAGTGTGAAG Chr9:106353946..106353965 59.9 55

*** Putative Vector Insertion (Chr 9: 106353966 - 106354314) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000345857 Chr9:106354315..106355246 AGCCCCTAAGGGAGATTTGA Chr9:106355124..106355143 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:106354016..106354036 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTACGTGACTGGGAAAACC Chr9:106354013..106354033 59.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042073