Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21797
Trapped Gene
Gtdc1 (ENSMUSG00000036890)
Vector Insertion
Chr 2: 44447400 - 44447511
Public Clones not available
Private Clones OST317662 (lexicon)
Severity of mutation (?) Insertion after 62% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000712267 (Chr2:44447401..44447510 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGCATGACAAAGATCCAG Chr2:44447491..44447510 58.23 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000712267 (Chr2:44447401..44447510 -)
Downstram Exon
ENSMUSE00000717339 (Chr2:44447401..44447510 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGCATGACAAAGATCCAG Chr2:44447491..44447510 58.23 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693251 Chr2:44717006..44717142 TCCTGACCTGCTTGAGTTCC Chr2:44717045..44717064 60.39 55
upstream ENSMUSE00000693250 Chr2:44715811..44715846 No primer for this exon
upstream ENSMUSE00000708537 Chr2:44715811..44715855 No primer for this exon
upstream ENSMUSE00000717993 Chr2:44715811..44715855 No primer for this exon
upstream ENSMUSE00000382626 Chr2:44680871..44681063 CACGCACAGCAGCCTTATAC Chr2:44680906..44680925 59.52 55
upstream ENSMUSE00000645480 Chr2:44680871..44681063 CACGCACAGCAGCCTTATAC Chr2:44680906..44680925 59.52 55
upstream ENSMUSE00000721982 Chr2:44680871..44681063 CACGCACAGCAGCCTTATAC Chr2:44680906..44680925 59.52 55
upstream ENSMUSE00000645476 Chr2:44644422..44644563 GCACGTGATTGGACTTCAGA Chr2:44644444..44644463 59.84 50
upstream ENSMUSE00000275833 Chr2:44611788..44611955 GCCTGATCTGGGAAAACTGA Chr2:44611885..44611904 60.19 50
upstream ENSMUSE00000275828 Chr2:44607567..44607740 CCTGATCACAGGCCTAAGGA Chr2:44607636..44607655 60.21 55
upstream ENSMUSE00000333997 Chr2:44490522..44490836 ATGCCCAAGCACAAAATAGC Chr2:44490813..44490832 60.1 45
upstream ENSMUSE00000712267 Chr2:44447401..44447510 GGAGCATGACAAAGATCCAG Chr2:44447491..44447510 58.23 50
upstream ENSMUSE00000717339 Chr2:44447401..44447510 GGAGCATGACAAAGATCCAG Chr2:44447491..44447510 58.23 50

*** Putative Vector Insertion (Chr 2: 44447400 - 44447511) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000275917 Chr2:44430963..44431107 TGCACAGTACGCGGAAATAG Chr2:44430993..44431012 59.9 50
downstream ENSMUSE00000693237 Chr2:44430963..44431107 TGCACAGTACGCGGAAATAG Chr2:44430993..44431012 59.9 50
downstream ENSMUSE00000275903 Chr2:44426733..44426803 GCTTTGGGACAGAGTGGGTA Chr2:44426737..44426756 60.11 55
downstream ENSMUSE00000693234 Chr2:44426733..44426803 GCTTTGGGACAGAGTGGGTA Chr2:44426737..44426756 60.11 55
downstream ENSMUSE00000275891 Chr2:44425939..44426030 TGGCCTCTTGCAGAAACTCT Chr2:44425944..44425963 60.13 50
downstream ENSMUSE00000693232 Chr2:44425939..44426030 TGGCCTCTTGCAGAAACTCT Chr2:44425944..44425963 60.13 50
downstream ENSMUSE00000645479 Chr2:44419942..44421054 GAATTCAGGCTCCGTGTCAT Chr2:44420555..44420574 60.08 50
downstream ENSMUSE00000693230 Chr2:44419942..44421054 GAATTCAGGCTCCGTGTCAT Chr2:44420555..44420574 60.08 50
downstream ENSMUSE00000693248 Chr2:44419932..44421054 GAATTCAGGCTCCGTGTCAT Chr2:44420555..44420574 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr2:44447442..44447462 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGCATGACAAAGATCCAGA Chr2:44447488..44447509 60.21 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036890