Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21818
Trapped Gene
Zfp456 (ENSMUSG00000078995)
Vector Insertion
Chr 13: 67473209 - 67473686
Public Clones not available
Private Clones OST316867 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000613591 (Chr13:67473687..67473813 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGAATTTCAGCCACCTTG Chr13:67473696..67473715 59.67 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000613591 (Chr13:67473687..67473813 -)
Downstram Exon
ENSMUSE00000613590 (Chr13:67473113..67473208 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGAATTTCAGCCACCTTG Chr13:67473696..67473715 59.67 50 GGTACACAGTGGCCATTCCT Chr13:67473094..67473113 59.85 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000486921 Chr13:67476626..67476699 GCGGAAATGATATTCGGCTA Chr13:67476653..67476672 60.03 45
upstream ENSMUSE00000613591 Chr13:67473687..67473813 GGAGAATTTCAGCCACCTTG Chr13:67473696..67473715 59.67 50

*** Putative Vector Insertion (Chr 13: 67473209 - 67473686) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000613590 Chr13:67473113..67473208 GGTACACAGTGGCCATTCCT Chr13:67473094..67473113 59.85 55
downstream ENSMUSE00000570434 Chr13:67464520..67468301 CTTTGCCACATTCCACACAC Chr13:67467236..67467255 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAACATTAATCGCCTTGCAG Chr13:67473621..67473641 59.33 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAACATCGTGACTGGGAAAA Chr13:67473621..67473641 59.54 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078995