Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21826
Trapped Gene
Sbno2 (ENSMUSG00000035673)
Vector Insertion
Chr 10: 79520610 - 79520700
Public Clones not available
Private Clones OST316685 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000311867 (Chr10:79520701..79520891 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACTGACACAGGAGGGCAAG Chr10:79520858..79520877 60.86 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000311867 (Chr10:79520701..79520891 -)
Downstram Exon
ENSMUSE00000311788 (Chr10:79519765..79520609 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACTGACACAGGAGGGCAAG Chr10:79520858..79520877 60.86 60 TGAAATTGATGTCGCAGCTC Chr10:79520276..79520295 59.96 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000455371 Chr10:79565355..79565447 No primer for this exon
upstream ENSMUSE00000311778 Chr10:79549002..79549177 CCAGCACCACAGAGTAAGCA Chr10:79549134..79549153 60.05 55
upstream ENSMUSE00000311767 Chr10:79546986..79547059 TTGTACCCCACCTTCTCCAG Chr10:79546995..79547014 59.96 55
upstream ENSMUSE00000311760 Chr10:79545360..79545471 AGAGCAGCGACTTTCCTCAG Chr10:79545360..79545379 59.89 55
upstream ENSMUSE00000574919 Chr10:79537973..79538184 AGCCGGTGACTAACCCTCAT Chr10:79538163..79538182 60.9 55
upstream ENSMUSE00000311750 Chr10:79535102..79535263 CTCAACGAGGTGCCTACCAT Chr10:79535139..79535158 60.13 55
upstream ENSMUSE00000455306 Chr10:79532713..79532796 CATTCTCGGCTCCTGAAGAC Chr10:79532758..79532777 59.95 55
upstream ENSMUSE00000641819 Chr10:79532356..79532452 GCCATGCTGAGACCTATGCT Chr10:79532375..79532394 60.39 55
upstream ENSMUSE00000641818 Chr10:79532027..79532181 CTAGCGCTACCCACCTCAGA Chr10:79532079..79532098 60.55 60
upstream ENSMUSE00000311834 Chr10:79531604..79531737 CAGTGGCTGGCATCATAGTG Chr10:79531639..79531658 60.29 55
upstream ENSMUSE00000312081 Chr10:79531430..79531520 ACGGGACCTGAGAGACATTG Chr10:79531465..79531484 60.11 55
upstream ENSMUSE00000312072 Chr10:79531073..79531216 ACTCTGCCCTGATTGGAGAA Chr10:79531148..79531167 59.8 50
upstream ENSMUSE00000312064 Chr10:79530022..79530139 TTCCACTAAGATGGGCAAGG Chr10:79530082..79530101 60.07 50
upstream ENSMUSE00000312058 Chr10:79529576..79529681 AGCCCCGCAACATGATATAC Chr10:79529653..79529672 59.81 50
upstream ENSMUSE00000455237 Chr10:79529295..79529448 CTGCCTTCCAGCAGGTCTAT Chr10:79529313..79529332 59.45 55
upstream ENSMUSE00000312041 Chr10:79527065..79527241 GCACCAGCGCTTCTTTAAGT Chr10:79527133..79527152 59.66 50
upstream ENSMUSE00000312033 Chr10:79526890..79526987 ACTCGAGAGGTGCTGGATGA Chr10:79526929..79526948 60.98 55
upstream ENSMUSE00000311816 Chr10:79526394..79526473 CAGAAGCACTTCCCTTCCAC Chr10:79526432..79526451 59.84 55
upstream ENSMUSE00000311904 Chr10:79525313..79525504 CCAGAATCCCTGGTAGACGA Chr10:79525360..79525379 60.06 55
upstream ENSMUSE00000574918 Chr10:79525162..79525504 TGAGGCCTATTCCACCAAAC Chr10:79525245..79525264 59.93 50
upstream ENSMUSE00000311895 Chr10:79524907..79525076 CAGTCAACACGTTGGACCAG Chr10:79524946..79524965 60.19 55
upstream ENSMUSE00000311999 Chr10:79524061..79524192 AGGAAAGGCCGAGTGGTATC Chr10:79524164..79524183 60.46 55
upstream ENSMUSE00000311994 Chr10:79523729..79523864 ACCGTGCCATTCAACAGTTT Chr10:79523730..79523749 60.42 45
upstream ENSMUSE00000311986 Chr10:79523534..79523646 CACAGGTCCAACCAGGTCTC Chr10:79523619..79523638 60.56 60
upstream ENSMUSE00000311979 Chr10:79523335..79523406 CCGAGACCTGAGCAAGTACA Chr10:79523349..79523368 59.03 55
upstream ENSMUSE00000311970 Chr10:79523139..79523247 GGCTATCCAGGAGGGGATAC Chr10:79523153..79523172 59.75 60
upstream ENSMUSE00000311963 Chr10:79522910..79522984 No primer for this exon
upstream ENSMUSE00000311888 Chr10:79522681..79522824 ACACCTTCGACCACCTCATC Chr10:79522724..79522743 59.97 55
upstream ENSMUSE00000311950 Chr10:79521550..79521644 CCTGGCATCAACGAGATACA Chr10:79521617..79521636 59.67 50
upstream ENSMUSE00000311883 Chr10:79521382..79521477 CTGGAGCTCAAAGGTCCCTA Chr10:79521407..79521426 59.42 55
upstream ENSMUSE00000311876 Chr10:79521161..79521292 CGTGTACAAGCCAAACATCG Chr10:79521214..79521233 60.17 50
upstream ENSMUSE00000367649 Chr10:79520998..79521074 GAGAGCAGCTATGCCCTGTC Chr10:79521025..79521044 60.13 60
upstream ENSMUSE00000311867 Chr10:79520701..79520891 GACTGACACAGGAGGGCAAG Chr10:79520858..79520877 60.86 60

*** Putative Vector Insertion (Chr 10: 79520610 - 79520700) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000311788 Chr10:79519765..79520609 TGAAATTGATGTCGCAGCTC Chr10:79520276..79520295 59.96 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTACAGATTGTGCGCCTTA Chr10:79520726..79520746 58.94 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTACAGATTGTGCGCCTTA Chr10:79520726..79520746 58.94 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035673