Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21829
Trapped Gene
Dapp1 (ENSMUSG00000028159)
Vector Insertion
Chr 3: 137628968 - 137644282
Public Clones (ggtc) (cmhd) IST13631G12 (tigm) IST12026D1 (tigm) IST10768D12 (tigm)
IST10691C3 (tigm) IST12478A11 (tigm)
Private Clones OST316371 (lexicon) OST199760 (lexicon) OST165903 (lexicon) OST141243 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000635672 (Chr3:137644283..137644481 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGAACTTATGGGCAGAGCA Chr3:137644372..137644391 59.84 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000635672 (Chr3:137644283..137644481 -)
Downstram Exon
ENSMUSE00000176860 (Chr3:137628845..137628967 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGAACTTATGGGCAGAGCA Chr3:137644372..137644391 59.84 50 GTCCATTGGAGAGCAGAAGG Chr3:137628887..137628906 59.8 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000635672 Chr3:137644283..137644481 AGGAACTTATGGGCAGAGCA Chr3:137644372..137644391 59.84 50

*** Putative Vector Insertion (Chr 3: 137628968 - 137644282) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176860 Chr3:137628845..137628967 GTCCATTGGAGAGCAGAAGG Chr3:137628887..137628906 59.8 55
downstream ENSMUSE00000176859 Chr3:137624406..137624539 GTCTCGCTTCCAATCAAAGG Chr3:137624386..137624405 59.81 50
downstream ENSMUSE00000176861 Chr3:137612611..137612741 GAACCCGGACTGATTCGTAA Chr3:137612645..137612664 59.93 50
downstream ENSMUSE00000176862 Chr3:137603825..137603872 TGGTGAGATAGCCTTCTTTGG Chr3:137603823..137603843 59.32 47.62
downstream ENSMUSE00000176863 Chr3:137602101..137602163 No primer for this exon
downstream ENSMUSE00000176858 Chr3:137600701..137600786 GATCCGAATTGGTTCTGGTG Chr3:137600744..137600763 60.32 50
downstream ENSMUSE00000176856 Chr3:137598546..137598633 ATCCATTCATCGGCTTCAAC Chr3:137598546..137598565 59.9 45
downstream ENSMUSE00000392006 Chr3:137595652..137596153 TTTCCATGGATCAGCAGACA Chr3:137595915..137595934 60.2 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACATAATCGCCTTGCAGCAC Chr3:137635214..137635235 61.17 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTGAAAAATCGCGTGACTG Chr3:137632223..137632243 59.46 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTTGCTAGCCAGAGACTCAGC Chr3:137635496..137635517 59.53 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCCATCTCTCTCGTGACTGG Chr3:137632422..137632442 60.82 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028159