Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21830
Trapped Gene
Mmrn2 (ENSMUSG00000041445)
Vector Insertion
Chr 14: 35188965 - 35209350
Public Clones D168B05 (ggtc) IST11656A3 (tigm) IST12565G6 (tigm) IST12835D2 (tigm)
IST12565G6 (tigm)
Private Clones OST316360 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000561719 (Chr14:35188690..35188964 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATTTCGCTTGAAGACCACA Chr14:35188722..35188741 59.84 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000561719 (Chr14:35188690..35188964 +)
Downstram Exon
ENSMUSE00000221942 (Chr14:35209351..35209479 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATTTCGCTTGAAGACCACA Chr14:35188722..35188741 59.84 45 GCCTGGACTTCTGGTAAGGA Chr14:35209382..35209401 59.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000561719 Chr14:35188690..35188964 CATTTCGCTTGAAGACCACA Chr14:35188722..35188741 59.84 45

*** Putative Vector Insertion (Chr 14: 35188965 - 35209350) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221942 Chr14:35209351..35209479 GCCTGGACTTCTGGTAAGGA Chr14:35209382..35209401 59.28 55
downstream ENSMUSE00000221934 Chr14:35209558..35209664 ATCAGCACCTTCTGCTGGAC Chr14:35209611..35209630 60.42 55
downstream ENSMUSE00000221927 Chr14:35209745..35209825 TCCATCGAGTCCCAAGTCTC Chr14:35209814..35209833 60.2 55
downstream ENSMUSE00000413364 Chr14:35210733..35210906 CTGGGCATCATTCTGGAGAT Chr14:35210821..35210840 60.03 50
downstream ENSMUSE00000365657 Chr14:35211016..35212809 GAAGTCAGCCCTAGCCACTG Chr14:35211221..35211240 60.01 60
downstream ENSMUSE00000689733 Chr14:35216099..35217473 GTTTCCAACCACAAGGGAGA Chr14:35216808..35216827 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr14:35192016..35192036 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATGTTCGTGACTGGGAAAA Chr14:35204010..35204030 59.54 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041445