Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21833
Trapped Gene
St6galnac4 (ENSMUSG00000079442)
Vector Insertion
Chr 2: 32445151 - 32449509
Public Clones not available
Private Clones OST316106 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000603963 (Chr2:32444965..32445150 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGCACTTCAGTGGCTACA Chr2:32445111..32445130 60.05 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000603963 (Chr2:32444965..32445150 +)
Downstram Exon
ENSMUSE00000603962 (Chr2:32449510..32449922 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGCACTTCAGTGGCTACA Chr2:32445111..32445130 60.05 55 TGTGGCACAGTTCTCGGATA Chr2:32449537..32449556 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000708108 Chr2:32442608..32442747 No primer for this exon
upstream ENSMUSE00000709973 Chr2:32442608..32442747 No primer for this exon
upstream ENSMUSE00000695062 Chr2:32443060..32443083 No primer for this exon
upstream ENSMUSE00000367433 Chr2:32443088..32443201 CATATCCTGGGACCAGCTTC Chr2:32443108..32443127 59.51 55
upstream ENSMUSE00000662702 Chr2:32443101..32443201 CATATCCTGGGACCAGCTTC Chr2:32443108..32443127 59.51 55
upstream ENSMUSE00000695066 Chr2:32443101..32443201 CATATCCTGGGACCAGCTTC Chr2:32443108..32443127 59.51 55
upstream ENSMUSE00000603963 Chr2:32444965..32445150 CCTGCACTTCAGTGGCTACA Chr2:32445111..32445130 60.05 55

*** Putative Vector Insertion (Chr 2: 32445151 - 32449509) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000603962 Chr2:32449510..32449922 TGTGGCACAGTTCTCGGATA Chr2:32449537..32449556 60.26 50
downstream ENSMUSE00000603961 Chr2:32451214..32451321 CCGTAGACCACGATCTCCTC Chr2:32451300..32451319 59.68 60
downstream ENSMUSE00000662701 Chr2:32452534..32452723 TGCTCATGCAAACGGTACAT Chr2:32452620..32452639 60.14 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTCACGAGAGGGTTAAAGCA Chr2:32448181..32448202 60 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTAGGCGTGACTGGGAAAA Chr2:32448196..32448216 60.77 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079442