Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2185
Trapped Gene
BC010304 (ENSMUSG00000038014)
Vector Insertion
Chr 13: 48993144 - 48997426
Public Clones XS0253 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000276529 (Chr13:48997427..48997676 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCAGCTTACAAGGGGAAAT Chr13:48997632..48997651 60.45 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000276529 (Chr13:48997427..48997676 -)
Downstram Exon
ENSMUSE00000276520 (Chr13:48993029..48993143 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCAGCTTACAAGGGGAAAT Chr13:48997632..48997651 60.45 50 TGGTCCGGCTCATAGAGTTT Chr13:48993023..48993042 59.69 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000571043 Chr13:49062724..49063386 GTGGCTTCTACACCGACTGG Chr13:49063003..49063022 60.71 60
upstream ENSMUSE00000454432 Chr13:49044426..49044672 TATCTGATGCACGAGGTTGC Chr13:49044479..49044498 59.83 50
upstream ENSMUSE00000454412 Chr13:49041311..49041393 CTGATGAGGATCTGGCTTCC Chr13:49041359..49041378 59.76 55
upstream ENSMUSE00000454406 Chr13:49029319..49029447 GCCACCCTGTGATGTAGTGA Chr13:49029405..49029424 59.55 55
upstream ENSMUSE00000276582 Chr13:49027666..49027762 CGGTTTAAGAGAGCAGTTGGA Chr13:49027718..49027738 59.5 47.62
upstream ENSMUSE00000276573 Chr13:49017522..49017619 ACCATATGTTCCCCCTCAGA Chr13:49017563..49017582 59.21 50
upstream ENSMUSE00000276565 Chr13:49017051..49017334 TGGACACTAGCGGGAAGAAC Chr13:49017236..49017255 60.26 55
upstream ENSMUSE00000276556 Chr13:49010231..49010318 AACAAGATTGGCTGGGAGAA Chr13:49010286..49010305 59.67 45
upstream ENSMUSE00000276547 Chr13:49008226..49008453 GTGTTGAGAGTGGCTGAGCA Chr13:49008278..49008297 60.19 55
upstream ENSMUSE00000276537 Chr13:49005625..49005799 TGGCAGAAAGCAGAAAGAAAA Chr13:49005667..49005687 60.12 38.1
upstream ENSMUSE00000276529 Chr13:48997427..48997676 GGCAGCTTACAAGGGGAAAT Chr13:48997632..48997651 60.45 50

*** Putative Vector Insertion (Chr 13: 48993144 - 48997426) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000276520 Chr13:48993029..48993143 TGGTCCGGCTCATAGAGTTT Chr13:48993023..48993042 59.69 50
downstream ENSMUSE00000149346 Chr13:48987250..48987459 TCACAGAGGTCGATGAGTGG Chr13:48987235..48987254 59.82 55
downstream ENSMUSE00000276504 Chr13:48985124..48985307 GTGCCGAGGGTATACAGAGG Chr13:48985148..48985167 59.57 60
downstream ENSMUSE00000276495 Chr13:48984493..48984630 GGGCCTGTTGCTACTGTTTC Chr13:48984560..48984579 59.74 55
downstream ENSMUSE00000276486 Chr13:48981106..48981247 TCTAGCTTCCCTCCCTGAGA Chr13:48981189..48981208 59.11 55
downstream ENSMUSE00000276478 Chr13:48980642..48980738 TGGAAATAACACCCCTTGGA Chr13:48980694..48980713 60.16 45
downstream ENSMUSE00000377549 Chr13:48974585..48976464 GGACTTGGATTCCCCAGATT Chr13:48976368..48976387 60.13 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGGGACCATTGTGTATGAT Chr13:48994387..48994407 59.34 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAGGGGGACCATTGTGTAT Chr13:48994390..48994410 60.05 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038014