Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21856
Trapped Gene
2410131K14Rik (ENSMUSG00000032840)
Vector Insertion
Chr 5: 118695468 - 118705678
Public Clones not available
Private Clones OST315409 (lexicon) OST275644 (lexicon) OST259702 (lexicon) OST58426 (lexicon)
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000344235 (Chr5:118695278..118695467 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCGGCCTCTCGCTAGTTTA Chr5:118695423..118695442 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000344235 (Chr5:118695278..118695467 +)
Downstram Exon
ENSMUSE00000290475 (Chr5:118705679..118705835 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCGGCCTCTCGCTAGTTTA Chr5:118695423..118695442 60.11 50 GAGGTTCCGGTCTCTCACAG Chr5:118705711..118705730 59.83 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000344235 Chr5:118695278..118695467 TTCGGCCTCTCGCTAGTTTA Chr5:118695423..118695442 60.11 50

*** Putative Vector Insertion (Chr 5: 118695468 - 118705678) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000290475 Chr5:118705679..118705835 GAGGTTCCGGTCTCTCACAG Chr5:118705711..118705730 59.83 60
downstream ENSMUSE00000290467 Chr5:118708985..118709136 CGCAGTACTCGTAGGCTTCA Chr5:118709113..118709132 59.24 55
downstream ENSMUSE00000290455 Chr5:118709384..118709497 GTGGTCTTCAACTGCCATGA Chr5:118709461..118709480 59.68 50
downstream ENSMUSE00000459574 Chr5:118711109..118713113 AAGCACGAGCAGACTGGATT Chr5:118712886..118712905 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTCCACCCCATGATCTCAC Chr5:118695422..118695442 59.77 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTCCACCCCATGATCTCAC Chr5:118695422..118695442 59.77 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032840