Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21862
Trapped Gene
9930104L06Rik (ENSMUSG00000044730)
Vector Insertion
Chr 4: 124614578 - 124615683
Public Clones D185F06 (ggtc)
Private Clones OST315245 (lexicon) OST84406 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000631295 (Chr4:124614292..124614577 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGCGACAAGACTGACTCC Chr4:124614441..124614460 59.99 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000631295 (Chr4:124614292..124614577 +)
Downstram Exon
ENSMUSE00000599263 (Chr4:124615684..124615961 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGCGACAAGACTGACTCC Chr4:124614441..124614460 59.99 60 GCTTGTCCAGAACAACGTCA Chr4:124615951..124615970 59.88 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000631295 Chr4:124614292..124614577 GAGGCGACAAGACTGACTCC Chr4:124614441..124614460 59.99 60

*** Putative Vector Insertion (Chr 4: 124614578 - 124615683) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000599263 Chr4:124615684..124615961 GCTTGTCCAGAACAACGTCA Chr4:124615951..124615970 59.88 50
downstream ENSMUSE00000599262 Chr4:124617610..124617789 GGTGTTACGGACCTTGAGGA Chr4:124617640..124617659 59.97 55
downstream ENSMUSE00000599261 Chr4:124619597..124619715 CAGTGGATGGAGGAGAGGAG Chr4:124619638..124619657 59.78 60
downstream ENSMUSE00000631293 Chr4:124619827..124621905 AGGAGAGTCAGTGGCAGGAA Chr4:124620987..124621006 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGACCGCCAGAATCAATA Chr4:124614583..124614603 60.04 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCGGTTACAAGACCGTGACT Chr4:124614616..124614636 60.18 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044730