Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21864
Trapped Gene
Rhbdf2 (ENSMUSG00000020806)
Vector Insertion
Chr 11: 116467547 - 116468541
Public Clones not available
Private Clones OST315155 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000709906 (Chr11:116468542..116468741 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000709906 (Chr11:116468542..116468741 -)
Downstram Exon
ENSMUSE00000332656 (Chr11:116467422..116467546 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000502648 Chr11:116488045..116488333 No primer for this exon
upstream ENSMUSE00000661070 Chr11:116485492..116485567 No primer for this exon
upstream ENSMUSE00000350587 Chr11:116471618..116471793 No primer for this exon
upstream ENSMUSE00000709304 Chr11:116468542..116468741 No primer for this exon
upstream ENSMUSE00000709906 Chr11:116468542..116468741 No primer for this exon

*** Putative Vector Insertion (Chr 11: 116467547 - 116468541) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000332656 Chr11:116467422..116467546 No primer for this exon
downstream ENSMUSE00000375676 Chr11:116466557..116466752 No primer for this exon
downstream ENSMUSE00000356444 Chr11:116466275..116466478 No primer for this exon
downstream ENSMUSE00000661068 Chr11:116465692..116465820 No primer for this exon
downstream ENSMUSE00000661067 Chr11:116465246..116465364 No primer for this exon
downstream ENSMUSE00000248123 Chr11:116464967..116465167 No primer for this exon
downstream ENSMUSE00000109435 Chr11:116463503..116463614 No primer for this exon
downstream ENSMUSE00000248111 Chr11:116463203..116463277 No primer for this exon
downstream ENSMUSE00000248102 Chr11:116462908..116463069 No primer for this exon
downstream ENSMUSE00000109436 Chr11:116462599..116462705 No primer for this exon
downstream ENSMUSE00000109459 Chr11:116462400..116462463 No primer for this exon
downstream ENSMUSE00000109450 Chr11:116462209..116462303 No primer for this exon
downstream ENSMUSE00000109433 Chr11:116461924..116461999 No primer for this exon
downstream ENSMUSE00000109437 Chr11:116461712..116461812 No primer for this exon
downstream ENSMUSE00000248056 Chr11:116461375..116461528 No primer for this exon
downstream ENSMUSE00000465409 Chr11:116459483..116460752 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATGTGACTGCCCACACAG Chr11:116468494..116468514 59.74 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGATGTGACTGCCCACACAG Chr11:116468494..116468514 59.74 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020806