Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21890
Trapped Gene
Hspbap1 (ENSMUSG00000022849)
Vector Insertion
Chr 16: 35801805 - 35814003
Public Clones (sanger)
Private Clones OST314666 (lexicon) OST119377 (lexicon)
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000131275 (Chr16:35801623..35801804 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAATTCTGGGCTTACGCTGA Chr16:35801736..35801755 59.85 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000131275 (Chr16:35801623..35801804 +)
Downstram Exon
ENSMUSE00000131273 (Chr16:35814004..35814140 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAATTCTGGGCTTACGCTGA Chr16:35801736..35801755 59.85 45 ACCCAAAGTCAGACCACACC Chr16:35814031..35814050 59.86 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000394995 Chr16:35770472..35770625 GAGGATCCTTCCTGTGTGGA Chr16:35770482..35770501 60.05 55
upstream ENSMUSE00000516388 Chr16:35787276..35787461 ACTGGACTGCGAAACACCTT Chr16:35787381..35787400 59.77 50
upstream ENSMUSE00000131275 Chr16:35801623..35801804 AAATTCTGGGCTTACGCTGA Chr16:35801736..35801755 59.85 45

*** Putative Vector Insertion (Chr 16: 35801805 - 35814003) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000131273 Chr16:35814004..35814140 ACCCAAAGTCAGACCACACC Chr16:35814031..35814050 59.86 55
downstream ENSMUSE00000325705 Chr16:35817238..35817409 GAACTGGGGGAAACACTTCA Chr16:35817370..35817389 59.94 50
downstream ENSMUSE00000131261 Chr16:35818765..35818848 TGACGGTGACAGGATCAAGA Chr16:35818828..35818847 60.25 50
downstream ENSMUSE00000131271 Chr16:35824775..35824885 No primer for this exon
downstream ENSMUSE00000386605 Chr16:35824969..35828532 TTTGGCTACTGAGCGATGTG Chr16:35826611..35826630 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGTGAGTCGCACATTTCT Chr16:35807803..35807823 58.88 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAGATCGTGACTGGGAAA Chr16:35807849..35807869 60.05 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022849