Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21893
Trapped Gene
Creb3l1 (ENSMUSG00000027230)
Vector Insertion
Chr 2: 91823590 - 91826317
Public Clones IST14179B5 (tigm) IST14910H11 (tigm) IST14488E11 (tigm) IST14578B3 (tigm)
IST14716C4 (tigm) IST14910E12 (tigm)
Private Clones OST314633 (lexicon) OST261269 (lexicon) OST135185 (lexicon)
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000299441 (Chr2:91826318..91826444 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTCTTCCGGCTCAATGACT Chr2:91826367..91826386 59.95 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000299441 (Chr2:91826318..91826444 -)
Downstram Exon
ENSMUSE00000370902 (Chr2:91823322..91823589 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTCTTCCGGCTCAATGACT Chr2:91826367..91826386 59.95 50 GTGCCGTTGTCATCAGTGTC Chr2:91823342..91823361 60.17 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000357520 Chr2:91864161..91864327 CTGGACTTGGGAGACCTGAA Chr2:91864186..91864205 60.23 55
upstream ENSMUSE00000167183 Chr2:91842002..91842230 TTGTGCCTGTCAAGATGGAG Chr2:91842015..91842034 59.83 50
upstream ENSMUSE00000167189 Chr2:91835414..91835598 AAACAAGCTGTGCTCCATCA Chr2:91835551..91835570 59.44 45
upstream ENSMUSE00000167186 Chr2:91833428..91833506 TGCCAGTGATCAAAGCAGAG Chr2:91833465..91833484 60.14 50
upstream ENSMUSE00000167193 Chr2:91832044..91832201 ACCTCGTACAGATGCCTCCA Chr2:91832179..91832198 60.68 55
upstream ENSMUSE00000167188 Chr2:91831283..91831432 GAAGAGGAGAAGCGGACCTT Chr2:91831377..91831396 59.96 55
upstream ENSMUSE00000167192 Chr2:91831066..91831124 GCCGCAAGAAGAAGGAGTAT Chr2:91831086..91831105 58.56 50
upstream ENSMUSE00000167191 Chr2:91830864..91830932 TGAGCTGTGGAAGAAAGTGG Chr2:91830886..91830905 59.01 50
upstream ENSMUSE00000360669 Chr2:91827193..91827292 TCTCCAGACCGTACAAGATGG Chr2:91827222..91827242 60.12 52.38
upstream ENSMUSE00000299441 Chr2:91826318..91826444 TCTCTTCCGGCTCAATGACT Chr2:91826367..91826386 59.95 50

*** Putative Vector Insertion (Chr 2: 91823590 - 91826317) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000370902 Chr2:91823322..91823589 GTGCCGTTGTCATCAGTGTC Chr2:91823342..91823361 60.17 55
downstream ENSMUSE00000502278 Chr2:91822487..91823164 TAGCAAAGCCCGCACTAACT Chr2:91822623..91822642 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCCTATCGCAGCTGACAGT Chr2:91826335..91826355 59.9 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCCTATCGCAGCTGACAGT Chr2:91826335..91826355 59.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCCCCAGATCCGACTAATAAT Chr2:91823465..91823486 59.31 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCCCCAGATCCGACTAATAAT Chr2:91823465..91823486 59.31 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027230