Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21929
Trapped Gene
Smg5 (ENSMUSG00000001415)
Vector Insertion
Chr 3: 88146487 - 88146801
Public Clones not available
Private Clones OST313977 (lexicon) OST257262 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000292662 (Chr3:88146363..88146486 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000292662 (Chr3:88146363..88146486 +)
Downstram Exon
ENSMUSE00000292657 (Chr3:88146802..88146958 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000382490 Chr3:88140182..88140419 No primer for this exon
upstream ENSMUSE00000337443 Chr3:88145780..88145878 No primer for this exon
upstream ENSMUSE00000292662 Chr3:88146363..88146486 No primer for this exon

*** Putative Vector Insertion (Chr 3: 88146487 - 88146801) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000292657 Chr3:88146802..88146958 No primer for this exon
downstream ENSMUSE00000292652 Chr3:88149285..88149374 No primer for this exon
downstream ENSMUSE00000292644 Chr3:88150367..88150456 No primer for this exon
downstream ENSMUSE00000292636 Chr3:88151440..88151518 No primer for this exon
downstream ENSMUSE00000292628 Chr3:88153064..88153189 No primer for this exon
downstream ENSMUSE00000383784 Chr3:88153298..88153366 No primer for this exon
downstream ENSMUSE00000332247 Chr3:88153938..88154146 No primer for this exon
downstream ENSMUSE00000414804 Chr3:88154619..88154756 No primer for this exon
downstream ENSMUSE00000468549 Chr3:88154901..88155503 No primer for this exon
downstream ENSMUSE00000415631 Chr3:88156885..88157060 No primer for this exon
downstream ENSMUSE00000415614 Chr3:88157798..88157873 No primer for this exon
downstream ENSMUSE00000349815 Chr3:88158454..88158629 No primer for this exon
downstream ENSMUSE00000386983 Chr3:88159500..88159658 No primer for this exon
downstream ENSMUSE00000514555 Chr3:88162575..88162634 No primer for this exon
downstream ENSMUSE00000175663 Chr3:88162949..88163108 No primer for this exon
downstream ENSMUSE00000175659 Chr3:88163470..88163560 No primer for this exon
downstream ENSMUSE00000175662 Chr3:88164253..88164327 No primer for this exon
downstream ENSMUSE00000175657 Chr3:88164676..88164814 No primer for this exon
downstream ENSMUSE00000388799 Chr3:88164947..88166259 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAGGACGCAGGTGAAACTTG Chr3:88146498..88146519 59.92 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGGACGCAGGTGAAACTTG Chr3:88146499..88146519 58.92 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001415