Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21933
Trapped Gene
Pcolce2 (ENSMUSG00000015354)
Vector Insertion
Chr 9: 95539180 - 95570423
Public Clones (ggtc)
Private Clones OST313695 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000235915 (Chr9:95539071..95539179 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000235915 (Chr9:95539071..95539179 +)
Downstram Exon
ENSMUSE00000235892 (Chr9:95570424..95570679 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000235944 Chr9:95538151..95538292 No primer for this exon
upstream ENSMUSE00000235915 Chr9:95539071..95539179 No primer for this exon

*** Putative Vector Insertion (Chr 9: 95539180 - 95570423) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000235892 Chr9:95570424..95570679 No primer for this exon
downstream ENSMUSE00000219483 Chr9:95578764..95578888 No primer for this exon
downstream ENSMUSE00000219484 Chr9:95581952..95582088 No primer for this exon
downstream ENSMUSE00000219479 Chr9:95587105..95587259 No primer for this exon
downstream ENSMUSE00000219478 Chr9:95593280..95593363 No primer for this exon
downstream ENSMUSE00000219481 Chr9:95595043..95595210 No primer for this exon
downstream ENSMUSE00000634936 Chr9:95595385..95595577 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTCCTGCACTGGTGTGTCA Chr9:95563168..95563188 60.37 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTCCTGCACTGGTGTGTCA Chr9:95563168..95563188 60.37 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015354