Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21957
Trapped Gene
Zmat3 (ENSMUSG00000027663)
Vector Insertion
Chr 3: 32240618 - 32242255
Public Clones (sanger) (sanger)
Private Clones OST312917 (lexicon)
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000171898 (Chr3:32242256..32242356 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACTCGGAAAGAAGGGAGT Chr3:32242311..32242330 59.68 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000171898 (Chr3:32242256..32242356 -)
Downstram Exon
ENSMUSE00000592911 (Chr3:32233714..32240617 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACTCGGAAAGAAGGGAGT Chr3:32242311..32242330 59.68 55 CGCCTACACGTCCCTAACAT Chr3:32238201..32238220 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676063 Chr3:32264426..32264587 CGACCGACTTTTGACAATCA Chr3:32264532..32264551 59.69 45
upstream ENSMUSE00000273004 Chr3:32259812..32260138 ACCTAATCGGCCTTCAACCT Chr3:32260030..32260049 59.96 50
upstream ENSMUSE00000171896 Chr3:32244380..32244502 CCATGGCAAGAAACTACGAAA Chr3:32244474..32244494 60.12 42.86
upstream ENSMUSE00000171893 Chr3:32242474..32242640 GGGTGATCCTGGCTACAGAG Chr3:32242596..32242615 59.68 60
upstream ENSMUSE00000171898 Chr3:32242256..32242356 GGACTCGGAAAGAAGGGAGT Chr3:32242311..32242330 59.68 55

*** Putative Vector Insertion (Chr 3: 32240618 - 32242255) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000592911 Chr3:32233714..32240617 CGCCTACACGTCCCTAACAT Chr3:32238201..32238220 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACGAGTCTGGCGTCTGTTA Chr3:32242202..32242222 60.05 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCCTGGGTGTACAAAGCA Chr3:32242224..32242244 59.17 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TAATAATCGCCTTGCAGCAC Chr3:32242289..32242309 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AAGGGAGTGAACGTGACTGG Chr3:32242297..32242317 60.15 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027663