Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21958
Trapped Gene
Fancc (ENSMUSG00000021461)
Vector Insertion
Chr 13: 63499486 - 63501541
Public Clones not available
Private Clones OST312861 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000118089 (Chr13:63501542..63501626 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000118089 (Chr13:63501542..63501626 -)
Downstram Exon
ENSMUSE00000118087 (Chr13:63499391..63499485 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000493369 Chr13:63532758..63533053 No primer for this exon
upstream ENSMUSE00000492433 Chr13:63504150..63504346 No primer for this exon
upstream ENSMUSE00000118089 Chr13:63501542..63501626 No primer for this exon

*** Putative Vector Insertion (Chr 13: 63499486 - 63501541) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000118087 Chr13:63499391..63499485 No primer for this exon
downstream ENSMUSE00000681588 Chr13:63463979..63463999 No primer for this exon
downstream ENSMUSE00000118068 Chr13:63462887..63463000 No primer for this exon
downstream ENSMUSE00000118075 Chr13:63461504..63461568 No primer for this exon
downstream ENSMUSE00000323534 Chr13:63448728..63448892 No primer for this exon
downstream ENSMUSE00000323527 Chr13:63441627..63441783 No primer for this exon
downstream ENSMUSE00000323518 Chr13:63433149..63433201 No primer for this exon
downstream ENSMUSE00000118069 Chr13:63431829..63431928 No primer for this exon
downstream ENSMUSE00000118073 Chr13:63426859..63426934 No primer for this exon
downstream ENSMUSE00000118071 Chr13:63424716..63424797 No primer for this exon
downstream ENSMUSE00000118067 Chr13:63423175..63423352 No primer for this exon
downstream ENSMUSE00000118066 Chr13:63418661..63418864 No primer for this exon
downstream ENSMUSE00000641507 Chr13:63418661..63418864 No primer for this exon
downstream ENSMUSE00000118077 Chr13:63418492..63418590 No primer for this exon
downstream ENSMUSE00000509789 Chr13:63413971..63414111 No primer for this exon
downstream ENSMUSE00000641508 Chr13:63413971..63414111 No primer for this exon
downstream ENSMUSE00000519176 Chr13:63406017..63407176 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr13:63501471..63501491 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAGTTTTGCTGTCTGCTTCC Chr13:63501489..63501510 59.53 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021461