Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21967
Trapped Gene
Rdm1 (ENSMUSG00000010362)
Vector Insertion
Chr 11: 101491675 - 101492133
Public Clones not available
Private Clones OST312689 (lexicon)
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000113079 (Chr11:101491552..101491674 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000113079 (Chr11:101491552..101491674 +)
Downstram Exon
ENSMUSE00000113085 (Chr11:101492134..101492293 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000113080 Chr11:101489274..101489378 No primer for this exon
upstream ENSMUSE00000113082 Chr11:101489587..101489766 No primer for this exon
upstream ENSMUSE00000113079 Chr11:101491552..101491674 No primer for this exon

*** Putative Vector Insertion (Chr 11: 101491675 - 101492133) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000113085 Chr11:101492134..101492293 No primer for this exon
downstream ENSMUSE00000113083 Chr11:101495116..101495214 No primer for this exon
downstream ENSMUSE00000113081 Chr11:101496102..101496187 No primer for this exon
downstream ENSMUSE00000342882 Chr11:101497062..101497395 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr11:101491724..101491744 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000010362