Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21977
Trapped Gene
Cln3 (ENSMUSG00000030720)
Vector Insertion
Chr 7: 133725257 - 133726277
Public Clones not available
Private Clones OST312289 (lexicon) OST284767 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000202307 (Chr7:133726278..133726356 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGGTTGGATAGTCGGAGTGT Chr7:133726305..133726324 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000202307 (Chr7:133726278..133726356 -)
Downstram Exon
ENSMUSE00000202293 (Chr7:133725160..133725256 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGGTTGGATAGTCGGAGTGT Chr7:133726305..133726324 59.99 55 CTGCTCCTGCTTGAGGATGT Chr7:133725159..133725178 60.56 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000669692 Chr7:133728809..133729331 GACACAAACGCACTGAAGGA Chr7:133728893..133728912 59.88 50
upstream ENSMUSE00000669691 Chr7:133727688..133727794 GCTGGAATCCATAGCAGAGG Chr7:133727739..133727758 59.8 55
upstream ENSMUSE00000588149 Chr7:133726817..133726961 TCGTCTACCTTGCGGAGAGT Chr7:133726833..133726852 60.01 55
upstream ENSMUSE00000705503 Chr7:133726817..133726850 TCTACCTTGCGGAGAGTTCAG Chr7:133726829..133726849 59.62 52.38
upstream ENSMUSE00000435508 Chr7:133726514..133726610 GGGACCCGAACTCAATGTTA Chr7:133726559..133726578 59.79 50
upstream ENSMUSE00000632420 Chr7:133726514..133726761 TGAAGCTAGCTCGGAACACA Chr7:133726600..133726619 59.74 50
upstream ENSMUSE00000669671 Chr7:133726514..133726704 TGAAGCTAGCTCGGAACACA Chr7:133726600..133726619 59.74 50
upstream ENSMUSE00000715977 Chr7:133726514..133726610 GGGACCCGAACTCAATGTTA Chr7:133726559..133726578 59.79 50
upstream ENSMUSE00000202307 Chr7:133726278..133726356 CGGTTGGATAGTCGGAGTGT Chr7:133726305..133726324 59.99 55

*** Putative Vector Insertion (Chr 7: 133725257 - 133726277) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000202293 Chr7:133725160..133725256 CTGCTCCTGCTTGAGGATGT Chr7:133725159..133725178 60.56 55
downstream ENSMUSE00000202287 Chr7:133724307..133724378 TGGAGATGGAGTTGCAGTCA Chr7:133724290..133724309 60.4 50
downstream ENSMUSE00000202290 Chr7:133723847..133723926 TTGATGACAAGGGTGGGAAG Chr7:133723864..133723883 60.89 50
downstream ENSMUSE00000202302 Chr7:133723658..133723743 GGCTTAACCCCACTGACTGA Chr7:133723642..133723661 60.11 55
downstream ENSMUSE00000202299 Chr7:133722915..133722987 CTAGCCCTGAGGAGATGCTG Chr7:133722933..133722952 60.11 60
downstream ENSMUSE00000202313 Chr7:133722687..133722830 CAGGGATCCCCAACATAGAA Chr7:133722681..133722700 59.74 50
downstream ENSMUSE00000202296 Chr7:133721323..133721435 TTCAGGAGACGTGAGCAACA Chr7:133721386..133721405 60.59 50
downstream ENSMUSE00000202284 Chr7:133719004..133719050 TTGAACACTGTCCACCTTTCC Chr7:133718983..133719003 60 47.62
downstream ENSMUSE00000202309 Chr7:133718858..133718926 CAGCACCAGAGGGATGATGT Chr7:133718872..133718891 61.1 55
downstream ENSMUSE00000202305 Chr7:133718717..133718772 AGTGTTCCGGAAAAACAGGA Chr7:133718724..133718743 59.57 45
downstream ENSMUSE00000295078 Chr7:133718508..133718601 GAACCGTATTCGGCAACATT Chr7:133718510..133718529 59.83 45
downstream ENSMUSE00000295073 Chr7:133715985..133716125 AGGTAGATGCTGGGCAAGAA Chr7:133716042..133716061 59.84 50
downstream ENSMUSE00000527216 Chr7:133715600..133715900 CAAACTCTCGGTGCTTGTCA Chr7:133715854..133715873 60.03 50
downstream ENSMUSE00000435129 Chr7:133714914..133715900 GTGTCGAGCAACTCCTGTCA Chr7:133715742..133715761 60.03 55
downstream ENSMUSE00000669679 Chr7:133714721..133715900 CAAACTCTCGGTGCTTGTCA Chr7:133715854..133715873 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAATGCAGTGGGTTTCTGGT Chr7:133726274..133726294 59.97 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAATGCAGTGGGTTTCTGGT Chr7:133726274..133726294 59.97 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030720