Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21982
Trapped Gene
Arf1 (ENSMUSG00000048076)
Vector Insertion
Chr 11: 59026448 - 59026644
Public Clones not available
Private Clones OST312178 (lexicon)
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000480117 (Chr11:59026645..59026755 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATATCAGCTTCACCGTGTGG Chr11:59026706..59026726 60.01 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000480117 (Chr11:59026645..59026755 -)
Downstram Exon
ENSMUSE00000579490 (Chr11:59026323..59026447 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATATCAGCTTCACCGTGTGG Chr11:59026706..59026726 60.01 47.62 TCGTTCACACGCTCTCTGTC Chr11:59026380..59026399 60.19 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000373310 Chr11:59041675..59041718 No primer for this exon
upstream ENSMUSE00000486396 Chr11:59026842..59027025 CTTAAGCTGGGCGAAATTGT Chr11:59026862..59026881 59.36 45
upstream ENSMUSE00000480117 Chr11:59026645..59026755 AATATCAGCTTCACCGTGTGG Chr11:59026706..59026726 60.01 47.62

*** Putative Vector Insertion (Chr 11: 59026448 - 59026644) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000579490 Chr11:59026323..59026447 TCGTTCACACGCTCTCTGTC Chr11:59026380..59026399 60.19 55
downstream ENSMUSE00000477891 Chr11:59024998..59026197 CAGCGAAACAGGTGATCTGA Chr11:59025507..59025526 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTAAGCAGCCAGTCCTTG Chr11:59026625..59026645 59.5 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTAAGCAGCCAGTCCTTG Chr11:59026625..59026645 59.5 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048076