Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI21987
Trapped Gene
Slc31a1 (ENSMUSG00000066150)
Vector Insertion
Chr 4: 62047198 - 62048900
Public Clones not available
Private Clones OST312050 (lexicon)
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000526771 (Chr4:62047125..62047197 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTTTTCCGGTTTGGTAATCA Chr4:62047165..62047185 60.21 38.1 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000526771 (Chr4:62047125..62047197 +)
Downstram Exon
ENSMUSE00000526770 (Chr4:62048901..62049069 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTTTTCCGGTTTGGTAATCA Chr4:62047165..62047185 60.21 38.1 GGCATGGAATTGTAGCGAAT Chr4:62049021..62049040 59.93 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000526773 Chr4:62021754..62021877 GGGCTTGGTAGAAGTCCGTA Chr4:62021798..62021817 59.19 55
upstream ENSMUSE00000526772 Chr4:62046526..62046712 CACGGACGACAACATTACCA Chr4:62046622..62046641 60.43 50
upstream ENSMUSE00000714463 Chr4:62046535..62046712 CACGGACGACAACATTACCA Chr4:62046622..62046641 60.43 50
upstream ENSMUSE00000526771 Chr4:62047125..62047197 TGTTTTCCGGTTTGGTAATCA Chr4:62047165..62047185 60.21 38.1

*** Putative Vector Insertion (Chr 4: 62047198 - 62048900) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000526770 Chr4:62048901..62049069 GGCATGGAATTGTAGCGAAT Chr4:62049021..62049040 59.93 45
downstream ENSMUSE00000716117 Chr4:62048901..62052803 CCGGGAGCTTACAGTCTCTG Chr4:62052726..62052745 60.01 60
downstream ENSMUSE00000526769 Chr4:62049632..62052802 CCGGGAGCTTACAGTCTCTG Chr4:62052726..62052745 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr4:62047248..62047268 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGATGACGTGACTGGGAAAA Chr4:62047242..62047263 60.1 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066150