Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22010
Trapped Gene
Pdcd7 (ENSMUSG00000041837)
Vector Insertion
Chr 9: 65204613 - 65206400
Public Clones not available
Private Clones OST311502 (lexicon) OST60634 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000247908 (Chr9:65204525..65204612 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCCGGCAGTATTACCTCCA Chr9:65204557..65204576 60.46 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000247908 (Chr9:65204525..65204612 +)
Downstram Exon
ENSMUSE00000247879 (Chr9:65206401..65207450 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCCGGCAGTATTACCTCCA Chr9:65204557..65204576 60.46 50 AGCTATCCAGCCCCTACCAT Chr9:65207245..65207264 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000400909 Chr9:65193875..65194815 CTCCTGGAACCCGGATAAAG Chr9:65193883..65193902 60.81 55
upstream ENSMUSE00000247952 Chr9:65202417..65202555 AAGGATGGTGGACATTCTGC Chr9:65202485..65202504 59.93 50
upstream ENSMUSE00000247927 Chr9:65204052..65204288 GAAGAGAGAGCCCTCCGAGT Chr9:65204147..65204166 60.1 60
upstream ENSMUSE00000247908 Chr9:65204525..65204612 TTCCGGCAGTATTACCTCCA Chr9:65204557..65204576 60.46 50

*** Putative Vector Insertion (Chr 9: 65204613 - 65206400) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000247879 Chr9:65206401..65207450 AGCTATCCAGCCCCTACCAT Chr9:65207245..65207264 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGGTACGGGAAGCTCTTA Chr9:65204646..65204666 59.7 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCTCTCGTGACTGGGAAA Chr9:65204657..65204677 59.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041837