Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22015
Trapped Gene
ORF19 (ENSMUSG00000024101)
Vector Insertion
Chr 17: 66465123 - 66465293
Public Clones not available
Private Clones OST311396 (lexicon)
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000657051 (Chr17:66465011..66465122 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCAGTAAGAAGGCCATCAA Chr17:66465102..66465121 60.21 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000657051 (Chr17:66465011..66465122 +)
Downstram Exon
ENSMUSE00000657050 (Chr17:66465294..66465440 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCAGTAAGAAGGCCATCAA Chr17:66465102..66465121 60.21 50 GGATCCTGTAACGGGGTCTT Chr17:66465405..66465424 60.19 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000508659 Chr17:66460963..66460989 No primer for this exon
upstream ENSMUSE00000706967 Chr17:66460984..66461071 No primer for this exon
upstream ENSMUSE00000606459 Chr17:66463203..66463356 GTGAAGACCCAGTGCTCCTT Chr17:66463217..66463236 59.31 55
upstream ENSMUSE00000706966 Chr17:66463203..66463356 GTGAAGACCCAGTGCTCCTT Chr17:66463217..66463236 59.31 55
upstream ENSMUSE00000657051 Chr17:66465011..66465122 GGCAGTAAGAAGGCCATCAA Chr17:66465102..66465121 60.21 50

*** Putative Vector Insertion (Chr 17: 66465123 - 66465293) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000657050 Chr17:66465294..66465440 GGATCCTGTAACGGGGTCTT Chr17:66465405..66465424 60.19 55
downstream ENSMUSE00000657049 Chr17:66465600..66465736 GTGTTCACACACACGGGAAA Chr17:66465637..66465656 60.46 50
downstream ENSMUSE00000657048 Chr17:66465969..66466101 TAGACAGAGGGGCATCGAAC Chr17:66466075..66466094 60.22 55
downstream ENSMUSE00000657047 Chr17:66466313..66466514 TCCGCACTGTACATCAGGTC Chr17:66466428..66466447 59.71 55
downstream ENSMUSE00000494160 Chr17:66466604..66466783 GTGGGGTACTGACCAATGCT Chr17:66466702..66466721 59.85 55
downstream ENSMUSE00000138360 Chr17:66467403..66467561 TGCTCCTGCTCCTTCTGTTT Chr17:66467562..66467581 60.13 50
downstream ENSMUSE00000138357 Chr17:66468151..66468219 CTGACATCAAGTCCCCACCT Chr17:66468189..66468208 59.96 55
downstream ENSMUSE00000384754 Chr17:66468337..66468787 CTCCTCATCCTCGTCTCCTG Chr17:66468464..66468483 59.94 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCAGTAAGAAGGCCATCAA Chr17:66465103..66465123 60.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCAGTAAGAAGGCCATCAA Chr17:66465103..66465123 60.21 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024101