Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2203
Trapped Gene
Lrrc1 (ENSMUSG00000032352)
Vector Insertion
Chr 9: 77300529 - 77302964
Public Clones XR0433 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000218993 (Chr9:77302965..77303109 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGGCAATCTGAAGAACCTC Chr9:77303086..77303105 60.34 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000218993 (Chr9:77302965..77303109 -)
Downstram Exon
ENSMUSE00000218995 (Chr9:77300410..77300528 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGGCAATCTGAAGAACCTC Chr9:77303086..77303105 60.34 50 TTTCACAATCCCCAATTGCT Chr9:77300426..77300445 60.31 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000390732 Chr9:77392272..77392677 CCGAGGAGATCTACCGCTAT Chr9:77392329..77392348 58.39 55
upstream ENSMUSE00000695503 Chr9:77391831..77391866 No primer for this exon
upstream ENSMUSE00000218986 Chr9:77347041..77347158 GCTCGTGGAACTTGACGTGT Chr9:77347050..77347069 61.32 55
upstream ENSMUSE00000218987 Chr9:77319959..77320037 AGCATCGCCTTCTGTAAAGC Chr9:77319998..77320017 59.62 50
upstream ENSMUSE00000218989 Chr9:77316365..77316454 TGACATCTCGCTGCAGTCTC Chr9:77316384..77316403 60.3 55
upstream ENSMUSE00000218982 Chr9:77305878..77305934 ACCTGGCTTCACTGGAACTG Chr9:77305907..77305926 60.3 55
upstream ENSMUSE00000218990 Chr9:77305638..77305701 No primer for this exon
upstream ENSMUSE00000218985 Chr9:77305197..77305271 CAGAATCAATTGGGGCACTC Chr9:77305251..77305270 60.46 50
upstream ENSMUSE00000218993 Chr9:77302965..77303109 TCGGCAATCTGAAGAACCTC Chr9:77303086..77303105 60.34 50

*** Putative Vector Insertion (Chr 9: 77300529 - 77302964) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000218995 Chr9:77300410..77300528 TTTCACAATCCCCAATTGCT Chr9:77300426..77300445 60.31 40
downstream ENSMUSE00000218991 Chr9:77299165..77299248 TGTCTGCATTCAAGTTGCTCA Chr9:77299172..77299192 60.59 42.86
downstream ENSMUSE00000695489 Chr9:77297335..77297394 CAGACCTTGCCTGAAATGTG Chr9:77297350..77297369 59.29 50
downstream ENSMUSE00000218984 Chr9:77289984..77290099 CCTCTGCAGGTAACCGAGTC Chr9:77290008..77290027 59.87 60
downstream ENSMUSE00000218992 Chr9:77282854..77283026 TGTCTGTCTGGAACGTGAGG Chr9:77282907..77282926 59.86 55
downstream ENSMUSE00000218983 Chr9:77281801..77281937 CGTCCTTCTCGTCTTCCAAA Chr9:77281796..77281815 60.37 50
downstream ENSMUSE00000695502 Chr9:77278896..77280087 CAGTAAGGCACGGAGTGGAT Chr9:77279329..77279348 60.13 55
downstream ENSMUSE00000372323 Chr9:77278630..77280087 CAGTGACTGGCACTCTGCAT Chr9:77278680..77278699 60.06 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCACCACACACAGACACA Chr9:77302931..77302951 60.43 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCACCACACACAGACACA Chr9:77302931..77302951 60.43 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032352