Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22031
Trapped Gene
Ubr4 (ENSMUSG00000066036)
Vector Insertion
Chr 4: 138936778 - 138944282
Public Clones (sanger) (sanger) (sanger) (sanger)
Private Clones OST311095 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000377299 (Chr4:138936602..138936777 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTACTCCGCCTTCGAGATGA Chr4:138936721..138936740 60.49 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000377299 (Chr4:138936602..138936777 +)
Downstram Exon
ENSMUSE00000347588 (Chr4:138944283..138944380 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTACTCCGCCTTCGAGATGA Chr4:138936721..138936740 60.49 55 TCGTACTGCTTCTCGTGGTG Chr4:138944321..138944340 60.05 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000377299 Chr4:138936602..138936777 CTACTCCGCCTTCGAGATGA Chr4:138936721..138936740 60.49 55

*** Putative Vector Insertion (Chr 4: 138936778 - 138944282) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000347588 Chr4:138944283..138944380 TCGTACTGCTTCTCGTGGTG Chr4:138944321..138944340 60.05 55
downstream ENSMUSE00000403106 Chr4:138946755..138946858 AGACGCAGGAGGGAAAACTC Chr4:138946827..138946846 60.77 55
downstream ENSMUSE00000343228 Chr4:138947700..138947829 AGCGTCTTCACTGTCTGTGG Chr4:138947824..138947843 59.05 55
downstream ENSMUSE00000399791 Chr4:138947935..138948074 TGAGGTCAGCTGGTTCAAAA Chr4:138948026..138948045 59.42 45
downstream ENSMUSE00000352042 Chr4:138948699..138948801 ACTCTTGGTCTTGGCAGCAG Chr4:138948764..138948783 60.59 55
downstream ENSMUSE00000376224 Chr4:138948932..138949073 GCATCCTGAAACCGATTGAT Chr4:138949010..138949029 59.9 45
downstream ENSMUSE00000338486 Chr4:138949210..138949334 TTGCAGACGAGAAGGATTGA Chr4:138949300..138949319 59.52 45
downstream ENSMUSE00000374176 Chr4:138952472..138952596 AATCGTGGCTGCATCACTTT Chr4:138952587..138952606 60.67 45
downstream ENSMUSE00000409305 Chr4:138953068..138953127 GCCTGTCCAATCATGTCGTA Chr4:138953099..138953118 59.53 50
downstream ENSMUSE00000596698 Chr4:138953209..138953399 AGGCTATTAAGCAGGCACCA Chr4:138953261..138953280 59.87 50
downstream ENSMUSE00000596697 Chr4:138955477..138955576 ATCACCGAGAGTACCCCAAA Chr4:138955509..138955528 59.4 50
downstream ENSMUSE00000596696 Chr4:138955712..138955849 CAATCAGCCGTTGAATCCTT Chr4:138955796..138955815 60.07 45
downstream ENSMUSE00000596695 Chr4:138956240..138956357 TGCTGTCCTCCTCTGTGCTAC Chr4:138956353..138956373 60.6 57.14
downstream ENSMUSE00000596694 Chr4:138957196..138957383 GGCTTTTAACCCGAGGAGAG Chr4:138957324..138957343 60.2 55
downstream ENSMUSE00000596693 Chr4:138958424..138958583 TGAGAGAGAGGCGCTCAGAT Chr4:138958525..138958544 60.4 55
downstream ENSMUSE00000596692 Chr4:138958662..138958747 AGAGCAGCAGCAAAGTCCTC Chr4:138958695..138958714 59.9 55
downstream ENSMUSE00000596691 Chr4:138962394..138962563 GTCCCACACTTTCAGGCATT Chr4:138962564..138962583 59.97 50
downstream ENSMUSE00000596690 Chr4:138963628..138963910 AGCATGGTCAAGATGGCTCT Chr4:138963774..138963793 59.83 50
downstream ENSMUSE00000596689 Chr4:138964455..138964590 CTGCTGTCTTGGGATCCACT Chr4:138964516..138964535 60.26 55
downstream ENSMUSE00000596688 Chr4:138964754..138964833 GGACAGGACGCAGTAGAACC Chr4:138964794..138964813 59.73 60
downstream ENSMUSE00000596687 Chr4:138965588..138965716 CAGGGCTGTCACGTTCTTCT Chr4:138965719..138965738 60.44 55
downstream ENSMUSE00000596686 Chr4:138966003..138966185 TTGAAGGTGGCAAAATTCCT Chr4:138966072..138966091 59.55 40
downstream ENSMUSE00000596685 Chr4:138966322..138966444 TGTCGGGCAAAGTACTCCTC Chr4:138966446..138966465 60.26 55
downstream ENSMUSE00000596684 Chr4:138966537..138966766 GGTGAACGAGGCATAGGTGT Chr4:138966767..138966786 60 55
downstream ENSMUSE00000596683 Chr4:138968541..138968662 CACCTACTGGAGCCGATAGC Chr4:138968648..138968667 59.86 60
downstream ENSMUSE00000596682 Chr4:138969327..138969424 CAGGATCCAATGTTGGGAAA Chr4:138969426..138969445 60.69 45
downstream ENSMUSE00000596681 Chr4:138970258..138970415 CTGCACGGCACTGATGTAAC Chr4:138970317..138970336 60.33 55
downstream ENSMUSE00000524437 Chr4:138970385..138970415 AATCAGATCCCCAGTCAACCT Chr4:138970415..138970435 59.81 47.62
downstream ENSMUSE00000281754 Chr4:138970915..138971124 ACTCATCAGACTCCGCAGGT Chr4:138971054..138971073 59.87 55
downstream ENSMUSE00000281745 Chr4:138972468..138972569 ACTCCTCCAGGATGGACTCA Chr4:138972499..138972518 59.64 55
downstream ENSMUSE00000281739 Chr4:138972771..138972871 AGAGGTCCTCATTGGCTGTG Chr4:138972820..138972839 60.26 55
downstream ENSMUSE00000281733 Chr4:138973106..138973304 TCCAGCTGGTCAGAATCCTT Chr4:138973244..138973263 59.8 50
downstream ENSMUSE00000281724 Chr4:138974317..138974505 TAGAGTGGCCATCACAACCA Chr4:138974440..138974459 60.11 50
downstream ENSMUSE00000281715 Chr4:138975083..138975146 CATTGGCATTCAGCTTCTCA Chr4:138975135..138975154 59.95 45
downstream ENSMUSE00000281709 Chr4:138976294..138976485 TTGGGCCTTGACCATTACTC Chr4:138976387..138976406 59.93 50
downstream ENSMUSE00000281701 Chr4:138976996..138977066 No primer for this exon
downstream ENSMUSE00000281693 Chr4:138977146..138977293 ATGGCATACCTTTGCACACA Chr4:138977218..138977237 59.99 45
downstream ENSMUSE00000281686 Chr4:138977612..138977839 GGAAACCCTAGGTTCGCTCT Chr4:138977695..138977714 59.71 55
downstream ENSMUSE00000281679 Chr4:138978308..138978478 TGTCCACTGTGTGCAGTTCA Chr4:138978452..138978471 59.9 50
downstream ENSMUSE00000343345 Chr4:138979742..138979924 TGTGAGCCTAAGGTGGGAAC Chr4:138979764..138979783 60.11 55
downstream ENSMUSE00000281660 Chr4:138980675..138980833 CCAGGTAGTCCTCCTTGCAG Chr4:138980819..138980838 59.86 60
downstream ENSMUSE00000281654 Chr4:138981128..138981280 GCCAACTGGGGATGTAACAC Chr4:138981201..138981220 60.24 55
downstream ENSMUSE00000281646 Chr4:138981614..138981841 GTTCTTGCCTTCCTCGTTGA Chr4:138981721..138981740 60.38 50
downstream ENSMUSE00000281640 Chr4:138982693..138982850 ACCTGCCCTGACTGTAGCTG Chr4:138982786..138982805 60.47 60
downstream ENSMUSE00000281634 Chr4:138983950..138984121 GTTCATCACCTCGGACCACT Chr4:138984010..138984029 59.97 55
downstream ENSMUSE00000281627 Chr4:138984405..138984606 CATGGTTGTACGTTGCTGCT Chr4:138984467..138984486 59.79 50
downstream ENSMUSE00000281606 Chr4:138985407..138985570 AAGAGGTCATTACCGCCAAA Chr4:138985503..138985522 59.57 45
downstream ENSMUSE00000281598 Chr4:138986039..138986255 GCCGAAGATCTCGATGTAGG Chr4:138986161..138986180 59.8 55
downstream ENSMUSE00000281592 Chr4:138987460..138987676 TCAGGTTAGGAGGGCAGATG Chr4:138987609..138987628 60.21 55
downstream ENSMUSE00000416497 Chr4:138988397..138988429 CCAGCTTGGTTAGGGACTCA Chr4:138988428..138988447 60.25 55
downstream ENSMUSE00000596680 Chr4:138989535..138989598 CAGGGCTTCCAAAGAACTCA Chr4:138989565..138989584 60.37 50
downstream ENSMUSE00000596679 Chr4:138989909..138990043 AGGAGGCTCTTTGATTGCTG Chr4:138990003..138990022 59.57 50
downstream ENSMUSE00000281580 Chr4:138990925..138991099 AGGTTGTTAGGGCGTGTGAC Chr4:138991061..138991080 60.03 55
downstream ENSMUSE00000667584 Chr4:138991864..138991947 CCCCAATCAATATGCCAACT Chr4:138991926..138991945 59.65 45
downstream ENSMUSE00000416475 Chr4:138992037..138992174 CTACAGCCGTCTCCTTCCTG Chr4:138992091..138992110 60.01 60
downstream ENSMUSE00000524435 Chr4:138992988..138993109 ACCAACGCATTAACCGTAGC Chr4:138993027..138993046 60.03 50
downstream ENSMUSE00000714688 Chr4:138993965..138994076 GTTCCTGGGCCTTAGGACTC Chr4:138994027..138994046 60.07 60
downstream ENSMUSE00000715787 Chr4:138993965..138994076 GTTCCTGGGCCTTAGGACTC Chr4:138994027..138994046 60.07 60
downstream ENSMUSE00000524433 Chr4:138996326..138996456 TTCTCATCTGCGTCATCGTC Chr4:138996368..138996387 59.95 50
downstream ENSMUSE00000667582 Chr4:138996326..138996456 TTCTCATCTGCGTCATCGTC Chr4:138996368..138996387 59.95 50
downstream ENSMUSE00000524432 Chr4:138996560..138996737 GTTTCCAGGACCATCGACTC Chr4:138996585..138996604 59.51 55
downstream ENSMUSE00000667581 Chr4:138996560..138996737 GTTTCCAGGACCATCGACTC Chr4:138996585..138996604 59.51 55
downstream ENSMUSE00000365965 Chr4:138997107..138997211 CTGCGTCCAGAGAGGAAGAG Chr4:138997187..138997206 60.28 60
downstream ENSMUSE00000667580 Chr4:138997107..138997211 CTGCGTCCAGAGAGGAAGAG Chr4:138997187..138997206 60.28 60
downstream ENSMUSE00000524431 Chr4:138998601..138998738 No primer for this exon
downstream ENSMUSE00000667579 Chr4:138998601..138998738 No primer for this exon
downstream ENSMUSE00000524430 Chr4:138999314..138999488 CGTCACCATATGCACTGCTC Chr4:138999346..138999365 60.3 55
downstream ENSMUSE00000630777 Chr4:138999314..138999488 CGTCACCATATGCACTGCTC Chr4:138999346..138999365 60.3 55
downstream ENSMUSE00000524429 Chr4:139000510..139000606 CAGCATCAGACGAACCATGT Chr4:139000537..139000556 59.71 50
downstream ENSMUSE00000630798 Chr4:139000510..139000606 CAGCATCAGACGAACCATGT Chr4:139000537..139000556 59.71 50
downstream ENSMUSE00000524428 Chr4:139001159..139001266 CTTTTTGTCCATGCCCAACT Chr4:139001269..139001288 59.97 45
downstream ENSMUSE00000667578 Chr4:139001159..139001266 CTTTTTGTCCATGCCCAACT Chr4:139001269..139001288 59.97 45
downstream ENSMUSE00000524427 Chr4:139001774..139001890 TCTCATCACGACCAAATGGA Chr4:139001836..139001855 60.05 45
downstream ENSMUSE00000667577 Chr4:139001774..139001890 TCTCATCACGACCAAATGGA Chr4:139001836..139001855 60.05 45
downstream ENSMUSE00000524426 Chr4:139002774..139002983 TACTGGCGGAGAAAGAATGG Chr4:139002979..139002998 60.21 50
downstream ENSMUSE00000667576 Chr4:139002774..139002983 TACTGGCGGAGAAAGAATGG Chr4:139002979..139002998 60.21 50
downstream ENSMUSE00000524391 Chr4:139004737..139004886 TGGTGTCTGCGATCTTCTTG Chr4:139004833..139004852 59.98 50
downstream ENSMUSE00000524425 Chr4:139004737..139004886 TGGTGTCTGCGATCTTCTTG Chr4:139004833..139004852 59.98 50
downstream ENSMUSE00000281547 Chr4:139006230..139006457 TCGGAGCTGTCGGTATTTCT Chr4:139006328..139006347 59.84 50
downstream ENSMUSE00000667575 Chr4:139006230..139006457 TCGGAGCTGTCGGTATTTCT Chr4:139006328..139006347 59.84 50
downstream ENSMUSE00000281542 Chr4:139007161..139007239 No primer for this exon
downstream ENSMUSE00000667574 Chr4:139007161..139007239 No primer for this exon
downstream ENSMUSE00000281540 Chr4:139007643..139007887 TTGGACTGAGTTGTGGCTTG Chr4:139007841..139007860 59.87 50
downstream ENSMUSE00000487099 Chr4:139007643..139007888 TTGGACTGAGTTGTGGCTTG Chr4:139007841..139007860 59.87 50
downstream ENSMUSE00000667573 Chr4:139007643..139007848 TTGGACTGAGTTGTGGCTTG Chr4:139007841..139007860 59.87 50
downstream ENSMUSE00000281536 Chr4:139008486..139008654 AAACAGCGCAGAAACTGGAT Chr4:139008591..139008610 59.88 45
downstream ENSMUSE00000281533 Chr4:139009050..139009194 GCTGAGCCTTGTTGGAGTTT Chr4:139009072..139009091 59.48 50
downstream ENSMUSE00000281526 Chr4:139009887..139009972 GAGTTGGGGTGATTGGTGAG Chr4:139009963..139009982 60.36 55
downstream ENSMUSE00000281519 Chr4:139011082..139011169 GCCGTCAAACTCCACTAAGC Chr4:139011115..139011134 59.88 55
downstream ENSMUSE00000281514 Chr4:139011363..139011556 GTCACCTTGCTGATGGTGTG Chr4:139011460..139011479 60.16 55
downstream ENSMUSE00000281508 Chr4:139013447..139013686 CTTCTGTCTGTCCGGGAGTC Chr4:139013505..139013524 59.83 60
downstream ENSMUSE00000281503 Chr4:139014010..139014148 CAAGGCTTGGCATAAAGCAT Chr4:139014108..139014127 60.23 45
downstream ENSMUSE00000281191 Chr4:139014714..139014839 GCAGAGCAGGTTCTCCAACT Chr4:139014809..139014828 59.6 55
downstream ENSMUSE00000281184 Chr4:139014941..139015069 TGCAGGATGTAGCGATTCAC Chr4:139015008..139015027 59.83 50
downstream ENSMUSE00000375047 Chr4:139015914..139016257 CAAAGAGCTCTCGGATGAGG Chr4:139016190..139016209 60.09 55
downstream ENSMUSE00000281168 Chr4:139017743..139017833 TGATCAGGTCGTTCATTTGC Chr4:139017786..139017805 59.65 45
downstream ENSMUSE00000281473 Chr4:139018093..139018177 GATGGAATCTGTCAGCAGCA Chr4:139018140..139018159 59.95 50
downstream ENSMUSE00000281462 Chr4:139018317..139018444 ACAACCACTGGCGTTTTGAT Chr4:139018368..139018387 60.42 45
downstream ENSMUSE00000596699 Chr4:139019195..139019324 ATAGGCAGGCACTTCTTCCA Chr4:139019322..139019341 59.84 50
downstream ENSMUSE00000281442 Chr4:139019413..139019570 CCACACGTACTTCTCGGTCA Chr4:139019489..139019508 59.74 55
downstream ENSMUSE00000281429 Chr4:139019900..139020009 AGCTTCCACGATGGTACAGG Chr4:139019962..139019981 60.13 55
downstream ENSMUSE00000281419 Chr4:139020457..139020598 AGGCGATGAGCTTCTGGTAG Chr4:139020533..139020552 59.6 55
downstream ENSMUSE00000281410 Chr4:139020874..139020955 No primer for this exon
downstream ENSMUSE00000281401 Chr4:139021209..139021382 AGCACAGGTACCCATTCAGC Chr4:139021301..139021320 60.14 55
downstream ENSMUSE00000281388 Chr4:139023128..139023249 CAGATTGTAGCGCTTTGCTG Chr4:139023195..139023214 59.78 50
downstream ENSMUSE00000281382 Chr4:139023921..139024118 GCATCCTGCCCTGTAGAAAG Chr4:139024002..139024021 59.84 55
downstream ENSMUSE00000281376 Chr4:139024705..139024785 CGGGAAGGTCCAGACTGATA Chr4:139024747..139024766 60.06 55
downstream ENSMUSE00000415964 Chr4:139025591..139025678 CCCGCATTCGATAAACAATC Chr4:139025627..139025646 60.29 45
downstream ENSMUSE00000281364 Chr4:139026114..139026241 ACCGGCCATTCTGTACACTT Chr4:139026157..139026176 59.48 50
downstream ENSMUSE00000281359 Chr4:139027220..139027327 AGAGTCCCCAGCATGACATT Chr4:139027323..139027342 59.53 50
downstream ENSMUSE00000281354 Chr4:139027647..139027766 GCTCTGCGTTGGATTCATCT Chr4:139027752..139027771 60.37 50
downstream ENSMUSE00000281347 Chr4:139028387..139028577 TCTCCGAAGGACAGGTATGG Chr4:139028523..139028542 60.06 55
downstream ENSMUSE00000281340 Chr4:139028986..139029159 CTTGATACCGGCAGCAATTT Chr4:139029061..139029080 60.1 45
downstream ENSMUSE00000281332 Chr4:139029452..139029551 TTTCCAGATGTCAGCATCCA Chr4:139029476..139029495 60.2 45
downstream ENSMUSE00000281324 Chr4:139032046..139032264 AGCTTATGCAGGCTCGTGAT Chr4:139032089..139032108 60.01 50
downstream ENSMUSE00000281314 Chr4:139033043..139033156 CAGGAGTGCAGTCTTGGTCA Chr4:139033087..139033106 60.02 55
downstream ENSMUSE00000181734 Chr4:139034833..139034975 ACCCGCTTGGTGAAAGTGTA Chr4:139034876..139034895 60.55 50
downstream ENSMUSE00000181727 Chr4:139035365..139035490 CAAGTGGCGAAAGCTGATTC Chr4:139035484..139035503 60.91 50
downstream ENSMUSE00000181728 Chr4:139036557..139036751 TCCTGGAGGTACGTGTTGTG Chr4:139036580..139036599 59.59 55
downstream ENSMUSE00000181733 Chr4:139038373..139038597 TCCACTTCTCTTTGGGCTGT Chr4:139038443..139038462 59.84 50
downstream ENSMUSE00000181732 Chr4:139041200..139041290 TAGTCCTTCACCGCCTTGTC Chr4:139041229..139041248 60.26 55
downstream ENSMUSE00000181730 Chr4:139041900..139042062 AGCCGCCCTCAGTGTTACTA Chr4:139041933..139041952 59.9 55
downstream ENSMUSE00000596678 Chr4:139045082..139045444 CCACTCCGAGAAAACTGAGG Chr4:139045274..139045293 59.84 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGCCTCAGTCATCGAGAG Chr4:138939759..138939779 60.98 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGCCTCAGTCATCGAGAG Chr4:138939759..138939779 60.98 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066036