Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22035
Trapped Gene
Cnn3 (ENSMUSG00000053931)
Vector Insertion
Chr 3: 121153277 - 121154300
Public Clones not available
Private Clones OST311051 (lexicon) OST237169 (lexicon) OST79101 (lexicon) OST65351 (lexicon)
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636205 (Chr3:121153210..121153276 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCAGGCTCTGTGAAGAAA Chr3:121153227..121153246 60.13 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636205 (Chr3:121153210..121153276 +)
Downstram Exon
ENSMUSE00000463156 (Chr3:121154301..121154438 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCAGGCTCTGTGAAGAAA Chr3:121153227..121153246 60.13 50 CATGGGGCTTCATACCGTAA Chr3:121154361..121154380 60.71 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000359223 Chr3:121129452..121129746 AGGGTGACTGACCGCTAGAA Chr3:121129647..121129666 59.87 55
upstream ENSMUSE00000636208 Chr3:121152867..121152988 CTAGGCATTGGCACCAACTT Chr3:121152933..121152952 60.13 50
upstream ENSMUSE00000636205 Chr3:121153210..121153276 AGCCAGGCTCTGTGAAGAAA Chr3:121153227..121153246 60.13 50

*** Putative Vector Insertion (Chr 3: 121153277 - 121154300) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000463156 Chr3:121154301..121154438 CATGGGGCTTCATACCGTAA Chr3:121154361..121154380 60.71 50
downstream ENSMUSE00000465196 Chr3:121154801..121154917 CGCCAATGTCAATGGTTGTA Chr3:121154843..121154862 60.38 45
downstream ENSMUSE00000563954 Chr3:121157865..121158011 CAGGCTAATCGTGGTCTGGT Chr3:121157984..121158003 60.13 55
downstream ENSMUSE00000391013 Chr3:121160000..121160867 GTCTGGGTACTCGCCATGAT Chr3:121160296..121160315 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCAGGCTCTGTGAAGAAA Chr3:121153228..121153248 60.13 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCAGGCTCTGTGAAGAAA Chr3:121153228..121153248 60.13 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053931