Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22066
Trapped Gene
Chchd10 (ENSMUSG00000049422)
Vector Insertion
Chr 10: 75400200 - 75400319
Public Clones CMHD-GT_392F3-3 (cmhd)
Private Clones OST309685 (lexicon) OST276976 (lexicon)
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000350915 (Chr10:75400052..75400199 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACTCAGAGCGACCTAACC Chr10:75400131..75400150 59.87 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000350915 (Chr10:75400052..75400199 +)
Downstram Exon
ENSMUSE00000451326 (Chr10:75400320..75400489 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACTCAGAGCGACCTAACC Chr10:75400131..75400150 59.87 60 CTCCCAGTCACATGGAACCT Chr10:75400419..75400438 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000451333 Chr10:75398638..75398749 GCTACGGTCCACGCTTCTTA Chr10:75398660..75398679 60.41 55
upstream ENSMUSE00000390495 Chr10:75398983..75399190 TGTAGGGCATGTCATGGGTA Chr10:75399109..75399128 59.8 50
upstream ENSMUSE00000350915 Chr10:75400052..75400199 CCACTCAGAGCGACCTAACC Chr10:75400131..75400150 59.87 60

*** Putative Vector Insertion (Chr 10: 75400200 - 75400319) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000451326 Chr10:75400320..75400489 CTCCCAGTCACATGGAACCT Chr10:75400419..75400438 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACGGTGAGCAGTCATTTTG Chr10:75400197..75400217 60.3 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACGGTGAGCAGTCATTTTG Chr10:75400197..75400217 60.3 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049422